Erinaceus_europaeus Locus Mono:81:SNORA27
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:81:SNORA27
Erinaceus_europaeus
Mono:81:SNORA27
scaffold_310470
SNORA27
1001..1125
2125
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTTTTTTTCTTTCTATATGAG
ATGCAACTGATGATTAAACCCAGGGCCTCATGTATGCAAAGGACATATGGGCTGAGCCAC
CTCCCCTGCCCCAAAAAGGTTACTTCATGTTAAAATAAGTCCCCTGCTGAAAACAACAAA
ATGATGCATCTGAATTTATATTTTCTTTTTTAAATTATTTTTGTTTTTATTTTTTCCTTA
TTTGGGGATTAACAGTTTACAGTCAACAGTAAAATACAGTAGTTTGTACATGTATAACAT
TTCTCAGTTTTCCACATAACAACTCACCCCCCTCTAGGTCCTCCTCTGCATCATGTTCCA
GGTCCTGAACCCTCCCCAGGAGGAGGAGGAGAACTTTTAAAAAGACTATATGGAATGAGT
GCTATTATCTATCGAGAAATTACTGAAGCATGCCACTGTCCAAGATCAAAGAACCATTCT
ATTTCCTTCCCCGTAATAAATTATTAGAAAGTGAGAAATTCTTTTCCCCTTTCACTTTGC
CAATTGGACTTGTCTTTATTGGTCATTCAAGTGAGGCAAAGGAAATACCCTTTTAAAACT
CAGGCAAACTGGGTGTTTGTCTTGTATCCTGTCAGAGGAAACAAAACCAAAAAAAAAAAA
AAAGAAAGAAAGTGAGAAATTCTTGGTACATACTACATCTGTTCTCTCACTTCCCCTCCA
CCTCATCCTCTCCATTTCCCAGATGAGAATGGCCTGGGAAGGACAGAAAGCTCCCTCTGG
ATGTGGGGTTGGTTACACTGATGGTAATGGCTGGCCTGGTCCACCACCATTGGGTGTTGT
GGCCCAGCGGTGTGCTGGGTGCAAAGCCCACAGACCAACCTACCCCAAGGTAAGAGCTGA
TGGGGCAGTTTGACAAGAACCTATCAAACTGCAGCCCCCAGCACCACAAATGTCCACTAC
CATTATCCTCAGGAAGGCAGTACTGATTTGCAGGCACAGAATATGAGCAGATGCTGAGTT
TATTTTCCTTTCCACTGCAACTCCGGTGCAGAACCAGCCCTGTACCTGCATGAGGAAGTA
TGCAGGTCATCCCTGGGAAGAGGGAATGCTACTTGCCTGAAGCTTGAGTTGGGTAGTGGT
ACACCTGGCTGAGTATACGTGATACTATGCACAAGGATGCAAGGCTCAAGCCCCAAGTCC
TCACCTGCAGAAAGGACACTTCATGAGCAGTGGAGCAGTACTGCAGGTGTCTCTCCTTCT
GTCTCCTCCTCCCCCATTCTCTCTGCCCTATCAAATAAAAGAAAGAGAGGAGGGGAAGGA
AAGGAAGGAAGGAAGGAAGGAAGGAAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGAAGA
AAGGAAGGAAGCAATTGGAGACCTTGTGTGTTCTGAAAGAATAAAGAAGCTTGACAGGCT
CTGAAAGAATAACCCTAACCTCTCCCCATCCCTCTGTGTGATCTAGTTTCCTCTCAGGCT
TTATTGGTTCACGATGGAGTTGTGGATGTGAGATTTGATTTCCTGGGCCCCATGTTAATT
GTGGCAGGTGACCAGTTGAGTATTTTCAATTTGGAACCAGGAAGTGGGTTTATGTCTAAT
AGCTGTCACACCGACTTCCTTGCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved