Erinaceus_europaeus Locus Mono:421:SNORD65
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:421:SNORD65
Erinaceus_europaeus
Mono:421:SNORD65
GeneScaffold_8103
SNORD65
1001..1073
2073
CATAGGAAGTGCCGTCAGATGCGACAGCTGACGAGAATTCCTGGCTGATGGCAGTCCAC
AAGCCCCCGCACGCTGTGCTGTGAGGATTAGGCGGTGGCAAACTGCCGCTGACACTGCAC
TCAGCCAGGTCGCCGTGAGAGAGTGGCCGGGTATGAGATGCGGGAGCCCTGTCCCTCAGG
ATGGCAGCCTTCGCCCGCCGAGAGTTCAGCTGCGGTCTGTGGGGAGAAGTGACTGGACCG
GCCCGACCTGGAGAGTTCTGGCAGGTGTGGTACCCGGATGGGACTCCGGCCTTTATTCGT
TGCGCCACTTGCCAGGCTGCGGTGTCCTGGACTTCAGGGACTGCCGGTTTACCACATGTG
TCAGTGATCAAAGGCACTTGGGATGAGTTTACAATAATGTGTGCCACTTTTGTGGGTTTT
TTTTTTTTTTAAGCAGAGCACTGTTCAGTTCTGGCTTATGGTGGTGCGGGGGACTGAACC
TGGGACTTTGGAGCCTTCAGGCATGAGTCTGTTTGCAGAACCATTATGCTGTCTACCCTC
GTCCCCACGGTGGTTTTAATGAAAACACTGTTCAGCTCTGGTGGTGCTGGGGATTGAACC
TGGGGCCTCAGGGTGGTTTTCCCATGACCCTTTATGCTCTCTCCGGCCCTGGATTTTCTT
TGGCAGCCCTGGCTGTTCTCTTTTTTGGTCAAGAGGTCACAGTGGGTGCTCCCATGTAGT
GCCCTGAAAGAGGAGTAGAGCTGTTGCCCTACCCAGCAAGGTTTGGGCAGCGTCAAGATA
AGACAGGTTCTCTCATTGAAACCATCACATAAGTGAATTTCTTTTCTGTTCTCAGCATCT
GCTTGGTGTAGGCTGATGCCTTAAGAGATGAGAACTGCTGGAGAATGAGCAGTGAGGTCA
CAACTCGAGGTAAGGGTAAGCTCTGACCCGCCAGTGATCCCTCCTCAGACCAGAGTGGGC
ATGTTCGGGGTGGCATGGGCATAGACTACGGAAAGGATATCAAATGATGAGATCACCCAA
AATAGCTGGAATTACCGGCAGAGTGTGCAGTGGTGAGCCTAAGGTTTTCTGAAGATATCC
TGTAGTGCTGTGCATGAGGGTGGACAGGAGTAGATGAGACTGATGCTTAGTTTCTTTGCA
GGTCTCTTCACCAGAGGATACAGCTGGAGCGAATCTGAAGGTGCAGACCTGTGGGCTGTC
CACTAGTTTGGACAGAAAAATCAGTAACAGTTGTAGAAATGTGCCTCTTGTATCAGTGCC
CTACGACCTGTGAATCTGCATCCTAGGAGCACTATTTATTCAGTTAGAAGTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved