Erinaceus_europaeus Locus Mono:481:SNORA2
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:481:SNORA2
Erinaceus_europaeus
Mono:481:SNORA2
GeneScaffold_994
SNORA2
1001..1140
2140
GGTTCTTTTTTTTTTTACTCTTAAAAACTACTCTATCATTTAGTATAATTAATAACTTT
CTTGAACCTTCATAATTACATGTCAACAATGCCTATGCACTGCTTCTTTAACTTAACAGT
TAAATCACAACTAAAAATAAAACCACAGTGCTAATGAACCACAGTGCCAAGATAAAATCA
ACGTCCATTATGCACTAGGGCAATGTATTTGAAATGCATTCAAGTACAAAAGGGCTTTTT
GTAAATAATCTAAGAAGCAGTCTACAGTAAAATTTCATTGAAGTACTTTGCTTCATAAAG
CAGCATTTTAGCAAGAGTTTTCAAGAACTGTGTTCCAAGTCAACTACGCAAGGAACATTT
AACTTTTCTCTAACTTGCATCAGCACAGTGAGAGTGAACTTGCATTCAGTAACATGATGG
ATCATGTCAGACAGGCAGAACAGCCAAAATAAAAGTCACAATTTAAGAAACACTCTATGA
AAATTAAAAAGGATGTTTTTCTCTTTTAGAAAGAATAGGTTTATGACTATCATAGGAAAA
ACTGACTTATTGTAACTGATAAAGTTGGATGGATCTGTGACTCCGATCCAGATGCATATA
AGACAAAACTTTAATGATCATTAAGATCTCTATAGATTGGCATTACTGCAAAATTTATTT
ATAAGGAAACTCTCCGCCCACTGTAGGATTGAGTAAATTGCCAACATTCTTCTCAATGGG
ACATCAAATTAAGTCATAATACCCAAGCAGCAGAAACTGACTCAAGACTATAAGGAAAAT
ATTTAAATCAAATATATGAATTAAGAAAGTTAGTTTTGTGGTCCAGGAGGTGGCGCAGTG
GATAAAGCGCTTGATTCTCAAGCGTGAGGTCCTGAGTTCAAGCCCTGGCAGCACATGTAC
TAGTGTGATGTCTGGTTCTTTCTCTCTCCTCCTCCTATCTTTCTCATCAATAAATAAATA
AAATCTTTAAAAAGAAAAAGAAAGAAAGAAGGGAAGAAAGGAAGAAAGAAAGAAAGAGCA
AACTTCTCATTGAAGCTGTTGGTTTCAAGCAAGAGTCTAAAAAAAAAAAATCTTTCTCTG
GTCTGTTGGCCATTTCAGAACTTTGGAGATATAATGGTCAATTCATTAGCAAGAAAACAG
CTGAGTGATTGGTGCCAGATGCGGACTGATACTTATCTATAGTCAGTTAATACCCTGATC
CTAAAATACAGAGATCCCTGATGTAACTTTTTAATTTGAATTATAATACCATTAAATTAT
CATTTGAATAAAGAGATCAGTCTAAAAAAAAGTTTTATGCACTTAGCATAGGAATAGAAG
CTGAAAATTACTAAAGATTTATGATATGATGGCTGCCTTCATTTGTGTTCTCTCTACGTA
CTGTACTACTTACTACTCTGTACTAGTTACTACAGGGCTATTTGTTTAAAAAATCATCTC
TAATAGCATACTTTGCTTTCAGTGTAATATATCACCACTGATTCAGCTAAACACTTCTGT
ACTTATTTCAAGCTGGAAAACTGGGTGATTATGAGTATCCTGATGATTACAGTTAAGTAC
AGATATATATTACCACAGCAAGAATATAACACTTAACACTGAATTGACATTAAATGAATA
GAAGGTCTTTCTTTTGACAGACCTTCTATTCAGAACAGACCAGAGTTACAAAAACTTGAA
AACATACCTGGCTGTCTGCGCTTATTAACAGTCTAAATTCGAAGAGTGGAGAATTTATTT
GTATTAATATAAAGTCATTGAACCAAGATGAGTGTTGAAAGTCACAGTATTTCTCAATTT
CCTGGCAATGCAATGAAGATGATCATAAAATAAATTTTATGCAAAAATGTTACAGATCAG
AATTACCACATTCTGAACAATGTGTAGTAAAATGAAATAACATCTGCATCCTTAAATTGA
CAAAGGTTAACATAACTAGAGGATATAATGGCATTTTGACTCTCAAGTGACAGGTTAGAT
AATATTCAAAAAAGTTTACCAAAGATAATAAAGACAGATATTGATGAAGAAGGTTTTACA
TCTCCTGAGATACAGCCTGAGTTGTCCTAAAAAAAAAAAAAAAAAACAAAAACACCAGGG
GCCAAGTAAAAATTAAAAATGACAAATATTTGCCCTGATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved