Erinaceus_europaeus Locus Mono:268:SNORD18
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:268:SNORD18
Erinaceus_europaeus
Mono:268:SNORD18
scaffold_371007
SNORD18
1001..1070
2070
CCTCCATAAATCATGGTCCTTAACTTTGGTTCTAAACATAGTTATAAAATGAATTAAAA
AAAAAATCAAAATATACTCTAATTTAAGCTAAAAAGCTTTGGGCCCTGCTTTTTAACTTT
AAGGCATGTGTGTTCTCTACTATAACAACATTGTACAAATTTACAATCACATGCATGATC
TACAGTAAAAAAAAAAGTTTTGGTTACAGTGTTTTTAAATTGGGGATCACAACTCAGCGC
CTATTATGCTATAACTAATAGGCAGCAGCAGTGTCACATACTACGCCACTCCCTCCATAG
TCTAGCGCAAGGGTCAATGAGAGCCCAGAAATGTTAAAAATCTTATGCCTACTTGGATAA
TCTGTATACATTTTCTATAGGTTTTCTTTTTTTTTTTTCTTTCCCTCCAGGGTTATTGCT
GGGCTCGGTGCCTGCACCATGAATCCACCGCTCCTGGAGGCCATTTTTCCCCCTTTTTGT
TGCCCTAGTTGTTGCAGCCTCGTTGCGGTTATTATTGCCATTGTTGACGTTGCTTTGTTG
TTGGATAGGACAGAGAGAAATGGAGAGAGGAGGGGAAGACAGAGAGAGAGGGGAGAGAAA
GATAGACACCTGCAGACCTGCTTCACCACCCGTGAAGCGACTCCCCTGCAGGTGGGGAGC
AGGGGGCTCGAACCAGGATCCTTACTCTGGTCCCTGCGCTTTGCACCACGTGTGCTTAAC
CCGTTGTGCTACTGCTGGACTCCCAAGTTTTGCTTTTTTACATTTATTTTTTGTTATTGT
TTTCCTATAGCATTACTCAGTTCTGGTTTATGGTGGTTGAGAGAGACTGATTTTGGGATC
TTTGGTGCCTTAGGCATGAAAGGCTTTGCATAACCATTATGCTGTCTTTCAAGCCCTCAA
AGCTTTAAAAAAAAACATTTATAATTTTTTATTGGGGGATTAATGGTTTACAGTAAACAG
TAAGTACAGTTGTTGACACATGTATAAAATTTCTCATTTTTCCTGGATGATGAGCTTCCA
CCCATGGTCCGTGTTTCTGAAATACATGATTTCTGTGGAACTTCTGATGTTTGGAAAAAA
AAAAATTCATTTTTCCTCAAAGCACTCTAACCTCCTGCCTAGGTCCTCCTCCACCATCCT
GCACTAGGACCTGAAAGCTCACCTCCCTTCCACCCCAGTCCTTAAGTGATTATACTGGCA
AATTGTTTAGCAATTGTTTCCCATTCCATTTTTGAGTTATAAATGACTAACATATTAGAG
TAATAGTAGGCAATTTCCTTGTACTTCCTGTAGTTTAAAATATTTCTTTCACTATCTGCA
ATCAAAAAATTTCTCCTATTTTGTTGTCTAAATGTATTTTTCATAGAAGACTCTAAAATA
CTGTTTCTTTCATTTATCTTCAGAACTCATCGCAATATTTTCACTCATGACATCAGTCGT
GACTTCATCTTTAAACCAAATGAAAAGACTTGGCATGANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved