Erinaceus_europaeus Locus Mono:495:SNORA73
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:495:SNORA73
Erinaceus_europaeus
Mono:495:SNORA73
GeneScaffold_2522
SNORA73
1001..1207
2207
TCTTTTTCTATTTCCTTGAATATTGACTCATAATTTTCAGTATACAAATCTTTCACTTC
TTTTGTTAGGTATATTCCTAGATACTTAATTTTTTTCTGCTATAATAAATGGAACTAATT
TTTTATATTTTTTCTTTATCTGACTTAGTGCTTGCATAGAGGAAGGCCACTGACTTTTGT
ATGTTTATTTTATAGCCTAACACCTTACTATATTGCCTGATAATATCCAGAAGCCTCCTG
CTAGATTCTTTAGGTTTTTCTATGTATACTATCATATCTTCAAATAGTGAGAGTCTGAAT
TCTTCCCTTCCAATTTGTATTGCTTTAACTCCTTTCTCTTGCTTGATGTTTATGGCAAGA
ACTTCAACATTATGTTGAATAATAATGGTGATAATGGGCAGTCCTATCTAGTACCGGATC
TGAGTGGGAATGCTTCCAGTTTCTCACCATTGAATATGATGTGGGCTGTATGTTTGCTTC
ATATGGATACCACTAGGTAAAGGAAATTTCCACTTATTCCCAGTTTTTGTAGTATTTTGA
TCATGAAATGATATTGTATTTTGTCAAAGGCATTCTCTGCATCTATTGAGATAACCATAT
GGCTTTTGGTTTTTCTTTTACTGATGTGGATCACAATGATTGATTTATGTACATTGAACC
AATCCCTGGAATAAGTCCCACTTGATTGTGATGTACAGTCTTTTTACTATACTTCTATAT
CTGGTTTGGCTAGAATTTTGTTCAATAATTTAGCAATAATGTTTGTTAGAAATATTGGTC
TATAGTTTTATTTTCTTTTCATTTTTTGTTGTGTCCCTTTCTGGATTTGTTATCACCATG
ATGTTGGCTTCAGAGAAGCTGAAAGGGAGGGGGGGCAGATAGCATAATGGCTATGCAAAG
GGATTCTCATGCCTAAAGCTCCAAAATCCCAGGTTCAATCCCGTGTACCAGCATAAGCCA
GAGCTGAGAAGGTCTCTGGTAAAAACAGACAAACAATAAAACCAACATGGATACCCCTGG
GAAGTCACTCTCCCCAGGCTCTGTGCAGGTGGCAAACAGTAGCACAGGGCTCTGCCCAAT
TATCTACAGTCCCTTTTTACAGTGTTGGAGATAAAGCTGAGCCACTGAGTTTGTGCCTGC
ATATTCTTACAGCATCCCAGAATTCCACGGACCCATAACTATGAAAACAAACCATGAACA
AAACAGTTTACCAGAAAACCCTCTCTGGGTATAGGTTATTTTCTTTCCATTCTATCAGTT
TTCCTGATTAAGCTCTTACCTTGTTTTGCAGCTTTCACTGGGAATTCTGAACAAGTTGAT
TAATGGGGAAATGTCTTCACCTAGCTTTAGTCCATTCAACTATATTGGGATCCTTTATCT
GGAAATGTTGTAAAGTGAATTATGAACAATTTCTAGAAGATAAACATTAAGTTTCAATTA
AAGAATTGAAGGTGCATCAAGAAGATAATAGCTCACTGGTATAGTCCATGACTTGCTATA
AGCTCTTACCTTGTTTTGCAGGATAAAGTCCCTGTGTAGTTGGGTTGTGGAATAGTGGGC
ATTTACTAAGTAGAAAGATAACCATGAGAAATAGATATGTCTATTTCATGGGTCTTGGAG
ATGGGAAACCCAATTAAGCACCTATGAAATTTCATGCCACCCAGCAGAGGGAGGTCCTGC
ATTCATCAAGATAGTAACCTGAGGGAGGAAAGTGGAAGATTACTTCCTCTGATAGTTGAT
TAGTCAGAAGTGATAGATAGGAGAGTTCCTTTGCCTCACGACCTCTCCAACAATTGGTGC
TTCTATTTTTCTAATGTATAGCATTATCAGAGTTGTGTAAAGTGATATCTCATTGTTGTT
TTATTTTTATTTTTTATTTTTATTTATAAAATTTCTATGACTAAAAGTTAATAGGAGTGT
ACATAAACACCATTCCCACCACCAAAATATTGTGGTTTTTTATTTACATTTTCCTGGTTA
TCAGTGACTATGAGCATTTTTTTGCACATTTCTTTTATTTATTTATTTAAAAAGGGAGAC
ATTAACAAAACCGTATGATATGAGGGGTACAACTCCATACACTTTCCACCATCAGATATC
TATATCCCATCCCCTCCCCTGATAGCTTCCCCCTTCTTTATCCCTCTGGGAGTATGGACC
CAAGGTCATTGTGGGTTGCAGAGGGTGGAAGGTCTGGCTTCTGTAATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved