Erinaceus_europaeus Locus Mono:333:SNORD49
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:333:SNORD49
Erinaceus_europaeus
Mono:333:SNORD49
scaffold_347561
SNORD49
1001..1065
2065
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGCCTGTTTGACATACTGTTTGACATCAGTATGCAGGACTTTTCAGT
GATCTAGCGGAAGAAGCACATACAAATGTATGCACATGTACTGCTCTGATGAAATCACTC
ATAGGAAGTGCCATCAGATGCGACAAATGTATGCACATGTATGCACAGCACAAGTTCTAC
ACACATATGTGCACACAATCAACTGAACATACTTGTTTCTGTTCTTGAGGAATGTAAAAT
CACCATGTATAATAATAAGTAGCTACTAGTCATTATTTTTTAAAGGTTTTATTTATTTAT
TAATGAGAAAGATAGGAGGAGGAGAGAAAAAGAACTAGACATCACTCTGGTACATGTGCT
GCTGGGGACTGAACTCAGGATTTCATGCTTTCGAGTCCAGTGCCCATCCACTGCACCACC
TCTCTGATCACATGCTACTAATTATTTACCACTTACTCTGCTGATCTCATACAAGCTTTG
TATATTTATCATTATTTTTAATCCTCAAAACCCTATCAAGTGGGTACCACTAGTACCATT
TTACAGATAGAAAGCTGAGACCCCAGTTTAAGACAATTACCTAAGTTCACGGAACTTAAT
AAGCATGAGAAGAGGATTTTGAAACTCCTGAATTCTGAGTCTTCAGTTTTAATCATTCTG
CTGTTTCTAAGAATCTGGGCTTTTCTTTACATCCACAGTCAGACATTTTTAGACTCAGAG
GGAGGATATTTCCAAATACCATTTCCCTAAGCTGACTCCCACCTTCCAGTCCCATTGTGG
CTGTGATTCCAAATGATCTAATGCTTGAAATGACAAAGGCTTTAGGAGTCTGCTTTGGCT
TGTTTTGCAGAGACCTACCTAGGAATTTTCACCAACCCCATCAGGAGGGAAAGTTTAGCC
AAGGCTTCTGACTTGGATGTAGGCACCAACAGTTATGTTATGACCTTCCCTCACTGGAAG
ATGGTTCCTAAGTGAGAGGAGTTGTGGGCAATCTCTACTGCCTGTCTCCTTAAAATTGTG
ATGTGAAAGTGCTGCTTCCCCTCTGCTTTCACCATTATCTGTCTCTTCCTTCCTGACCTA
GTGCCCTCTTTTCCTCATCACACAGAATCCTTGAAGAGATCACTACAAACCCAACTACAA
TGCCAGAAGACCCCTACTACATATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved