Erinaceus_europaeus Locus Mono:138:SNORD60
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:138:SNORD60
Erinaceus_europaeus
Mono:138:SNORD60
scaffold_249527
SNORD60
1001..1081
1839
GCCCCGCGACCCCTGCGCCGGGCGCGCCACGCGGACACTCACCCGCCCGCGGCCGCCCG
GGAGCGGCAGCGTCTCCCGCTCGTTCCATCGTGCCCCCTCGGCCTTCGGCCGGGACAGGA
CAGTACGCGCGAGACGGAAGCGCTCTGACGCGGAGCCCGACGGGACTTGTAGTTTGCAGG
CTGTCCAAAGCCTGGGAGGCCGCCCCGTGCTCGACACTCCAGAAACTACGACTTCCGGCG
GCTCTGACGTCACGGGGCGGGATTGGTAGGTCCAACTCACTCTATGTTGCAGATCGGAGT
TTGATTGGCTGAGTGTATCTGTCGCTCACAGCTTCAAGGGCTGCAAAGGGAGGAGCCTAG
GGTACCCGACCGGAAAGCCAATACAAAAAAAAAAAAAGAACAAGCGAGATTGGTCGCAAC
CCAGGGGACTGGAGAGCGGAGCGAATCGGCGGCAAGAGAAGGTGGGATTTCCGTCGGAAT
TGCCCAATCGCAATGGGGAGCGCACTTTCTATAAAAGCTTCAGCCTCGCCGGAGCTCGCT
CTTTCGGATTCGAGTTTTCTTCTGAAGTTGTGCTATTTGACAGTGCTCGGTGCTGGGGGC
AAAACTTGATACCGCGTGGGCCGGAGAGCGTCGCCAAACACTTCATACCGTTCTCGGCCG
GATTTCCAGCCTCAACCCGAGCCCGCCTCCGCTTCCGTTTACTTTGCTGCAGGTGAGGTC
TGCAGAAGACTGGCCGGGCAGGGTCGAGGGGGCACCCGAAGCCTGTGATGAGTCTTTCAT
TTCTGACACCTCGTATGAGAACTGCACGTGCAGTCTGATTAATTTGCAAGACTGAGGCTT
GAGGTGGGAGGAGGTGAGGGACAACCTGCTGGGGACAGGTGATTGTAACTGATTAATTTT
CCAGGGCCGCGAGGAGCAGCGCTGGCGACCTGGATCTGAAGTGGACAACCAGGGGCGAGC
TGGGTAAGGCTGGGGTCTAGGACCGAGCTACCAGCCACTTGTCAGTATGAAGCACTTGTA
ATAGGAAGTGGCCTTGCAGGGAGTACATGAGCCTGGGTAGGGGACCAGGAAGGAGTCACT
GCAGAAAACAAAGAGGAACTAATTACGGCGCTTTGTTAAGCAAATGACTCAACCAGGTTT
GTTGACTCCCGCGGGCCTCTGGGCCTGGATACCGCTAGTGCTCCAGGATCCATCTACCTC
CCAACAAAGGCAAAATGTAGCTTAATACCCTTTATTAAAAATTTATTTCCTTTTTGTTGC
CCTTTTTTTTTTTTAAATAGAAAAGGTTGCAGACTAGGAACCGGACGGTAACGGACCAGG
TTGAGCGTACACCTTACTTAGAATGTGCAAGGCCCCGGGTTCAAGCCCCCATCCCCACTT
CATAAGTGCTGTTAGGAGGGTTGCAGGTGTCTCTCGCTATTTCCCTTCCCCCTTCATTTC
AATTTAAGGGGTGTTCAGGTTGAGAGCAGAAGCAATGTTGTCTAGTGGGTCCTTCTCTTC
AGTGTTAGGTTTACTTAAATTCTTATTAGAGACAAATCAAGATGGAAAGGGGAGATAGGG
AGACAGCTGCAGATCTGCTTCTCTCTTGCAGGTGTGCCACCACCTGGCCCCTTGTTGAAT
CAGTTTTTATACCCTCTAGTAATGCGGAAGCAGCTCAAGTTACAAAAGCGGCTGTGGGGA
GTCAGGGGTAAGGATCGGGATTCTAGGACCCCGGCTCCCCTGCGGTGTCGCTTTACAGGC
GGTGAAGCAGGTCTACAGGTGTCCTTCCTCTCTTCCCCTCCATTTCTTTTGTCCTATCCA
GCAACGACGCCCATAGCAATAATAGCCACCAATAAAATAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved