Erinaceus_europaeus Locus Mono:402:SNORD83
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:402:SNORD83
Erinaceus_europaeus
Mono:402:SNORD83
GeneScaffold_8685
SNORD83
1001..1078
2078
TGTAGTCTAATAGCCAGGGACCAACTGGATCGTTATTTCCAGTGTTTACCTTTCTTTCT
ACAGCATAGAGCTCCTGGGGGGGGGTAGTGATGCGACGGGGGAGGAGTGAAGCTTATTCA
ATATGGTGGCTCTGGCGCCATTGTGTTCCCCTTTGATGTTACTTTCCCGGATCAGCTTCT
TGTTTAAAGGAGGCACCACCAATAAAAGCCATTACGCATTCTTTGGTCCAGGATACTTGC
GGAGGGCGGGCTCTCCACTTTGCCTTTCTGGGTCTTGTCGACCCACGGTGGGAATGCGGT
GTGCCGGCCTCTGGGCCTCCTTCGACCTTCCCAGTCTCCGTTTAATCACTCTCGCTTTGA
GCACTTCTCAGATGTTTGGGGGTGGTGTTTTGTGTTCATCTGAGAGGAGACTTACCCGAG
TCTTAACGGCGATGCTCTTGAGGTCACTTGGTAAAGATTCTGTTGAAGGAGGGACGAGGC
TATCTCGATATCCATCAGTTCTTAACGACCTTGTTACTCATCTATGATGGAATATGATTT
CCCCCTATGAATGAGCCACTTCTCCGAAATTTCGCGCCTCTGCCCTGTGCCACCAATTGT
AAAGACTTTTCCAAGCTCCACGAGGTGGGGTGTGTATGTGTGTGTAAAATCGGATTCTTA
GTAGAAAAGTAAGGGTTAGTTTATCTAGAAAGGGGGGGGGGACTCCTGAGAATGAGCTAA
GGGAGGAAAAAGGGCTGAAGAAGGAGGGTCCTGGGGGTGGATGGTGGAGCGCAGACATCT
TGCCCAAGGACCTGGGTTCAAGCTCCTGGTCCCCTCCGGGTTGCCGTGGGATGGGGGTGG
GTGGGCTTCACAAGTGGTGGAACAGTGCTGCTGGTGTCTTTCTACCTCTGCTTCTCTCTC
AATTTTTCTCTGTATCCGAGATAAATAAGTAAATATTCTTTAAAAGTTAAAAAAGGAGGT
TCTGAGGAGTTGGATGCTGGAGAACTGAGAAGTAGGTGGCGGCCACATGATGTTTTCACG
TTGAGAATTGAGTGCTTTGCACAATGATGACTTAAATCTATCACCCTTAACTGATGGCTG
CTATCTTAGGGGTAATAAAGAAAGCAGAGTCTGTCTTGCAGGTTTTTCAGGATTTGCCAC
TTCCATTATTCTCAGTCACTAGTCATTTCACCTGTTGATTATTAGTCTTTACCCTTTGTG
TCACGACTTGTAGATAAAGAATTTATAACTGGTCTTCCTTTCCCAAATTTCTACCAAGTG
CCTTTCCTGGGGGGGGGGGGGCTGTCCTCATTTCTGTTGCAACTCGTTTTTCTTTGTCTT
AGGTTTCTATTTTGTTTCTGTTACTTATTTTCCCAGGGAAAGGGTTCATAGTTTAGGGGA
AGTGCAGAGTGTGGAGATAGATAGAAAAGAGGTGGTGAAGACCCTGCTCGTGATTTATAA
GTCTTTTTTTTTTTTTCCTCCCTAGCTCTTCTGTCAAACTATTGTGTGTCTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved