Erinaceus_europaeus Locus Mono:217:SNORA66
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:217:SNORA66
Erinaceus_europaeus
Mono:217:SNORA66
scaffold_374573
SNORA66
1001..1128
2128
CTGAATATTTCAAATGAAGACATTAAGTTTTGGGGAGAGTGGTCCAGGAGTTGACATGA
GGACCTGAGTTCAGTCACATGGGGCAGAGTGATGTCTGGTTCTTTCTCTCCTCCTATCTT
CCCCATTAATAAATAAATAAAATCTTTTAAAAAAAATTTTGAGGAGAAATAAAGGATTAC
AGGCAAATTAGTCCCCATAGTATAATTCGCTTTGAAAAAGAGGAGCCCCACCGTGATTTC
AGTGTGCTAATGGCAGGATGACTAAAGTTTTAAGTTTGTTTCCACTCTCAGGGAAGAGCC
TTGTACCTGACATTCACAGTGTTCTGTACAAGGCATGATGAGCCCTGAAGGTAGTTATCT
AAGTCCACTGTGTTAAAATCCTAACACATAAATTATTGAATAGGCAGATTTGTGGGTTTT
TCCCTCCTTTTTTTGAGATTGCTTTTTAAAAATATTTATTTATTTATTTTCCCTTTTGTT
GCCTTTTTTATTGTTGTAGTTATTATTGTTGTTGTTATTGATGTCGCCATTGTTAGATAG
GACAGAGAAATGGAGAGAGGAGGGGAAGACAGAGAGAAAGTTAGACACCTGCAGGCCTGC
TTCACCGCCTGTGAAGTGACTCCTCTGCAGGTGGGGAGCCGGAGCTCGAACCGGGTTCCT
TACTCTGGCCTTTGTGCTTTGTGCTACGTACGCTTAACCCACTATGCTACTGCCAGACTC
CTTGCATTTTTTTTTTTAACTGAGAGAACTCGGAAAGATGAGTATTTCTTGAGTAAATGT
TAAGTGCCTAAGTCAGGAGCCCTATACCTCTCAAGCTGTGAAACTTCAGGACCATCTCTT
TCACTCCACTCTATTTCATCTGGGGGAATAACTGGTAGTTAAGGCTTTAGAACAGTTTTT
ATACCATATATATTGTATACATTTAAAATGCTAGTTATTTGTTATTCTATTACCTACATG
TTTTTGATCTGTTAAGTTTTTGAGAGTTCACAAATTTCAGTGTTCAAACTCAATCACTAA
CTGCATGTTTCAGAAGTGAGAGGAACTAGGTTTGCTAAAGTAATTGTGGTGATAGAATTG
TATAAACCTCAGAAACTACTGAGGTGGCCCATTCTATCCCAGTACAGTGTTAAAACATTA
TATAACCAGTAACCAAGTACCTTAGCCACTACTTTGTGAATCAGATATTGACATTTTACC
TTATTGTCTTATGTAGAGAGAACTTGACACATTTCCTTCCTTCCTCCCTCCCTTCCTTCC
TCCCTCCCTTTATTCCTCCCTCCCTTTCTTGCTTTAACATCTCTAAAATTTGATACATTT
CAAAATTAATGATGATTTTGGTTGTCAAAATAGTTTGCCTGGATGGTATGCTGGACATGT
GTGCACAACCCAGGTTTGAGCCCAGCCCCTACGCATTAGAGGAAGTTTTGATGATGTGGG
GTTTCTCCCTCTCCCTCTCCCTCTCCCTCTCTCTCTGTCCCTCCTGTCCTCTCCTACCCT
CTCTTCTTCCTTCTCCCCTCTCCCTATTCCTCCCTTTCTCTCTCTTCCCTCCCTCTCTTC
CCTCTGCCTCTTTCTCCTTCCTCCTCTTTTCCCTCTTCTTCCCTCTCCCTCTCTTCCTCT
CTCTCCTCCTCTTTCCCCCTCCTTCGCTCTCTCTTCTCCCTCCTTTCCTCTCCCTCTCCC
TCCCTTTCTCTCCCTGTCCCTCTCTCTTTTCTTTCCTTCTCTGCTCTGTCTTTTGCTTTA
TCTGAAAAAGTTGGTTTGAAGTAGTGGAGCCCAGAAGCAACAAAAGTCAAATAAAATTAA
TGACATTTTGTGGCAACTTTTTCCCCCAAGTGATACACAAAATAATAATGGCTTTTACAA
TTGAAAGCATCTTAGAATTGATAGCAGCATAATTTACATTACAGATAAAAATCAAATGAC
TTTTTTTCTTCTTTAGATTGTCATACCTGTTTATCCAGTTTTTCTTCATGCCTTAGAAGC
AATGACTAGCATAAATCTGTTGCGTATTTTTTGGATCATAATTATATATATTTATTTTTC
AGTATTTTTTATTGTTCTTATTATTGGCCTACATACATCAAGTAGTATCTATTTTATTTA
GACTTATATCTTCAATTTATATTGATTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved