Erinaceus_europaeus Locus Mono:474:SNORA70
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:474:SNORA70
Erinaceus_europaeus
Mono:474:SNORA70
GeneScaffold_7546
SNORA70
1001..1134
2134
AGGTACCACACTCCCCACAGACACACATTAGCAAGTGAGAGCAGAGAAAGACATAAAAG
CTACATGATGGCTGCATGAGTGGCAGTTGCAGGCTAGACAATTCCTGCTGCCTTCTGGGG
ACTTCTTTAAGGGAGACCACCAGGATCAGCCCTCCAGCCAGGGGGATATCTCCTGATCCT
TCCCTGCTCCCACCATTAATCTAGGAATAAAGGTCCTGAGGTAGCTCAGTTTTCTGCTGT
CGTCGGGCTCTGCTCTGACCCAGCAGTGGCCCGTTGGGCTGATTGTGTTCTCAGTCTCCC
ATGAAGGCATTATGTGACTCTGGAATGGGGGTTCCTCTTTACCTACGAGAGACTGCCAAC
AAGATTTCTAGCTGGGTGATCAGTGCTTCCGGTCTCCTGAGGTTCCTAGATCACCACTAT
CTCTGTACCCTAAGTACCTTCCTGTCTTCTTAAAGAAGGCATTGGCTCCAGATCCACAAA
AGAGAGCATCCTAACTGTAGCTTCCGATTGCCCCCCAAAAAAACAGACCAGTAAGCATAG
AGGACCACTACATGTGTGGGAGGTATAAGGATTTACAGAAAGAGACGACATAATGGACTA
TACAGGAGAAGCCAGCCCAATCTTTGTGGTGTTACTATGCATTTATTTTTTGCCAGAGCA
GTGCTAAATTCTGGCCTAGGGTAGTGCTGGGGATTGAACCTGGGACCTTTGGTACCTCAG
GCATGAAAACTTTTTTGTATAACCATTATGCTATCTTTCCACCTCTTTTCATGATAAAAT
AAATAAATATATAAGGTGACTCCCAGGGCCAGGTGGTGACACACCTGGCTAAGCATACAC
ACTAGTGAATGAGGACCCAGGTTCAAACCCCTGGTCCCCACCTGCAGGAGGGAAGCTTCG
CAAGAAGCAATACTGCAGGTGTCTCTCTGTCTCTCCCTTTCTAGCTCCCCTCCCCTCTCA
ATTTCTGTCTCTATTCAATGATAAATAAAAAATTAAAACATCTGCAGCCAATTAAGCCGA
CCATGCCACCCTCCCCATGGTGCCCGGTGTGCAGTGGCTGCAAACAGCAGCCTCCTGGGT
AGTATATGCAGCCTGTTGCTTGTATCAGCTGCCTTAAGGGACCCTGGAGACAGACCTTCC
TACTGTGTTCATTTTATGCCTGACCTCCTGCTGCCCCTAATCTTAGGCTCCAGACCGGGA
TGTGAGGTGCTTTTGGGAAGCCCCAGGGGACCGTGACCAGAGTCCACATTGGCCAGGTCA
TCATGTCCATCCAAACCAAGCTGCAGAACAAAGAACATGTGATCGAGGTCCTGCGCAGGG
CCAAGTTCAAATTCCCTGGACGCCAGAAGATCCACATCTCCAAGAAGTGGGGCTTCACCA
AGTTTAACACAGATGAATTTGAAGACATGGTGGCTGAAACGCGCCTCATCCCAGGCGGCT
GTGGAGTCAAATACATCTCCAACCGCAGTCCCCTGGACAAGTGACAGACCCTGCACACCT
GAGAGCCTCAGAGGTGTCCCTTATTAATTACAATAAATCAAGATCCTGCTTAGAAAAATT
AAAATAAAGTGGTGAGTTCCTAGGGGTGTGGCTTCTCTGTCTCTGGACTGAATCCCCAGC
TGTGTGGAGGTGTGGTATTTGAACAAAGCCCTTTCCTTACTAGGTCTCTGTGGTGGAACA
GCACTATCCCAGAGCTGCCTTCTTCCTACAAAGGAGAGCTATGGAGGTGTTCGAGAGGTA
CAGCCCAGGACTAGACAGAGGAGATGAGAGACAGACAGCTAAATAGGAGTGACTATCCTG
GCCTCAGCATTTGATCCTGAATTGGCAGAGATTTCTGTGTCAGGCGCTGGTTGGGTCTGT
GAAATCTGTTCTTCAAGATGGAGTCCCTTCCAGACAAGGCCACCACCTGGGTGCCTTGTG
CAGCCCCCACTCTCCAGACCTCTGGCCTGGTCCTTTCTCCTCCCTGCTCCTCTATGGTGA
GCTCAAGTGAGTGTCCAGGGGACATGGTGGGGTGGTGACAACTGAAGACACCCCTCCCCT
CAGCTTTAGGGGGATGGCTATGATGCCTCCCCCACGTTTTTTTTTTTTTTTTCTTCCTTT
CTTTACAGAGCACTGCTCTACTAGAGCTGATGGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved