Erinaceus_europaeus Locus Mono:190:SNORA16
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:190:SNORA16
Erinaceus_europaeus
Mono:190:SNORA16
scaffold_228551
SNORA16
1001..1136
2136
TTCAATAAATAAATAAATATAAATTTTTGAAAAGCCACCAGAAGCAGTGGACTCATAGT
GCCAGCACCAGTCCCGAGCTACTTCAGGCAAAAGAAAAGGCGGTGGCTCCGAGGGTTAAG
AGCACAAGATGTGAAGCGCAAGAACCTGCATAATGATCCTGGTCCGAGTCCCTGGCTTCC
CACCTGCAGGGGTGATCACTTCACAGGTGTTGAAGCAGGTCTGCAGGTGTCTATCTTTCT
ATCTCCCTCTCTGTCTTCCCCTCCTCTCTCAATTTCTCTCTGTCATATCCAACAACAAAG
ACAGCAATAACAAGAACTGTAGTAGCAACAACGATAACAACAAGGGCAACAAAGGGAAAA
GGATGGCCTCCTGGCGCAGTGGATTCCTAGTGCAGGCACTGAGTCCTAGTGATAAACCTG
GAGGAAAAAAAAGGGGGAAAGAAAGAAAAGAAAGGGGAGGGGAGGGGAGGGGAGGGGAGG
GGAGGGGAGGGGAGGGAAACCAACAGGCTCTAAACTCCTTAGTCAGATACTGTAAGTTTC
CTTCTTGTCCAAAATAAAAAATGTCAGTGATAATCATTTTCTTGTGATATTTCTAGAGTA
AAAAAAATCCAGGCTTAATGCTAAATTGTGAAGTTCTGCATATAGATGATGTGCAAATGA
CTACTGGAAAGTCAGATTTTCATAAGATTGTTAATTTGACTCTGTTTCCACTGTCAAAAG
CAGTGCTGGAATTAATTGATAAGCAGCTATCTCCAGGGTCTAGTGTGTGGAGAGTGGGAA
AAGTTCATTAACTAACATATGTACCCATTGAAATCTCAATGTAGAAATAGTCTTTGAAAA
GATTATGATATAGGAAGGTTACCAAAGGGTATTATTGAGTTTTTATTATCTAGATATCAA
TGAAAAACAATATAAATATATGTAGATAACAAGGAGAAATTTTATAATATAATAAGTTTC
AGTGAAGAAAAACTCAACTTGTTATTAAAAATTAACCTTTTTGTGGTCCTTATCGAAGCT
GCAGCTGTTTCCATTTAGCTGCTGTGGTCAAAAAGGAGCCCAAAGTGACATTTTTTCCTT
GACAGTCACCATTCTGTTTGTTGTAACAGTTCTGAAACATTTCAGGAAAAGACAGTTTCC
ATTGTATCTATTTTTTTTTTAATCAGAACACTACTCAGCTCTGACTTAGTAGTGCAGGGG
GTTGAACCTGGGACTTGGAGACTCAGGCATGAGAGTATCTTTGAATGACAATTATGTTAT
CTACTCCTACCCTTGATCAATTCAGGCCTTTAGTAGAAATTATCGTTTTTGGTCTTGTGC
AGTTATTAAAATAAGGCTTTTTTTTTTTTTTTTTTTACTGGATGCAGTTGGTGAACTACC
AGGTATAGTATACCTTGCTGTGCACAAGCACGTGGGTTCAAATCCATTATCCTCTCACTT
GTAGAAGGGAAAGCTAAGATAGTAAGTTAGTTCCAAGGCCTGTGCTATACTAAGGTTTTA
TTATTATTATTTATTTATGTAATTTATTTAATTTTCCCCTCAGCCTGAAATCTGATATGC
AGGTGGATCCAAGTTATTGTCTGGGGAGATGATGTCATGGCTGGAAAAAAATGACCAGAA
AGCTACATTAGAGAAGAGAGTAGCTCCGTAATATGAGAAAGGAATAATGGAGCCCCCCCT
CCAACTCTTCATCAGCACTATTCCAGCCTTTAGGTTCATGACTGGTCAACAATTTGTTTG
GCTTTATATGTTAACTCTCTTTTCAACCACCAGGTTCCAGATGCTAGCATGATGCCGACC
AGACTTCCTTAGACAGAGGACCCCACCAATGTGTTCTGGAGCTCCGATTCCCCAGAACCT
CACCCTACTAGGGAAAGAGAGAGGCAGACTGGGAGTATGGATTGACCTGTCAATGCTCAT
GTTCAGCGGGGAAGCAATTACAGAAGCCAGGCCTTCAACCTTCTGCATACCACAAGGACC
CTGGGTCCATACTCCCAGAGGGTTAAAGGACAGGAAAGCTATCATGGGAGGGGAGGGGAT
ATGGAGATATGGTGGTGGGAATTGTATGGCGTTGTACCCATCTTATAATATGGTTTAGTC
AATGTTTCCTTTTATAAATAAAAATTAAAAAGAATAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved