Erinaceus_europaeus Locus Mono:76:SNORA44
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:76:SNORA44
Erinaceus_europaeus
Mono:76:SNORA44
scaffold_285300
SNORA44
1001..1108
1622
AACCCCACCAATGTGTCCTGGAGCTCCGATTTCCCAGAACACCACCCCACTAGGGAAAG
AGAGGCAGGCTGAGAGTATGGATAGAACTATCGACACCCATGTCTCTTATCCTATGGTTT
CTGTCAGTGTTTCTTTTTTATAAATAAATAATAAAAAAGAAAATGTATTCATGAGAAATG
TATCATATTATTTTTGTTACTCTATCCTTTTTATTTTTATTGAGGGGTTTAGTGCTTTAC
AGTGCAATCACTGACATATGCAACCATTTCATTATGTAATAGACCCCCCCTCCAATTTTT
CTTCTTCTTCCTCCCCTAACACTGTTGCTGTAAACACACAAAGGTATTTTCACATGAATT
AGGAAAGTAAGATACAACATTATATCTTAATGGTGGTATTATACATCATAAGACTTATAT
TCTAAAATTGAATGTTTCATGTTTAATTAATAGTATAGTATTCATTTTTGGCCTTGTAGT
TCTAGGTAGCAGGAATACTAAACTGTAGGTTTTCTTAAAAAAAAAAAAAAAAAAACATGT
ATTTTTATTTGTTTCATTTTAATGAGAGAGCTATAGAGAGAGAGATCAGCACACTGCTCA
GTTTTGGCTATGGTTGTGTGGGAGACTGGAGTTTCAAGCATAAAAGATTTTTTTTTTTTG
CATAACCATTATACTGGCTCCTTTGCCAGAGGATATTGTTTCATTTGTCACCCTTATCAA
GAACCAAGCAGACTGACTTGATACTAGAACTTTAACATAAAGAAGATAGTCGGGTTTAAC
AGTGAAAAAATGAACAACTCAATTTAAAAAATGGCTACAAACCTGAATAGACAGTCTTCT
AAAACAGATAATACGTATGGTCCACAGGCATAGGACAAATGCTCTACTTCACTTATCCTC
AGAAAATGCAAATTAAAACCACATTGAGCTCCACCTCACACCATTAATGAAATAGGAAAT
GACAAGTGTTGAAAAAGATATGAAGAAAAAGGAACTCTGTTAAGCTTTTTGGTGAGGATG
GCACCAAACTGCCTGTAAGAATAACCTGGAGAGACTGACAGCACAGGTCAGCATAATACC
TGTAGCTGCCACTCAGCTTCCCTATATTCAGAACATGGGCTTTGATGCCTTTATCTTGGA
CGTTCACCAGTTTCGGTTAGAAAGAGTATAAGAAATTTTAACTTATTCAGCAGGTTTCCT
GGCAGTGTCAGATAGTGAAGACTGTGACAGAGACCAGTTGCCAGAGTTTTGCTTTCTAGT
AAGGTCTGTTACCAGTAAAGCTATCTTCGTCTGCTCCTAGGAGGTAATTGGCAATATAGA
GAAGGAGAATCAAAAAGAACCAAGCTGAGACAAGGAAAAGTATGGCAGGGGCTACAATGG
CCATAGTCTTGAAGATTAATCCAAAGTATCCCATCTTTCTCTGGTGTTAATAAAAGTAAA
ATATTTTGGGAGTTAGGCAGTAACACAGTGTGTTAAGTGCATGTGCTGCACAGTACAAGG
ACCAGCATAAGGATCCCAGTTAGAGCCTCTGGCTCCCCACCTGCAGGGGAGTCACTTCAC
AGGCGGTGAAGCAGGTCTGCAGGTGTCTATCTTTCTCTCCCCCTCTCTGTCTTCCCCATC
TCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved