Erinaceus_europaeus Locus Mono:155:SNORD32
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:155:SNORD32
Erinaceus_europaeus
Mono:155:SNORD32
scaffold_255962
SNORD32
1001..1082
2082
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTCACAAATGGCAGGGCTGCAGGTGTCTCTTTCTCTCTCCTTATCTTCAC
CTTCCCTCTCAATTGCTCTCTCTCCTATCAAATAAAGAAAAAAAAATTAAGTTTTTTTAA
ATATTTATTTTTAATTTCACCTGAGTACTGCTCAGCTCTGGCTTATGGTGGTGCTAGGGA
TTGAACCTGAGACCTCTGGCACCTCAGGCATAAAAGTATCTTTACATAGCCATTATGCTA
TCTCCCCAGCCACCCAAGAAAAAATTTTTAAGAAAAGAAGGCCACCAGAAGGTGAGGATT
CATTATGTAGTCACTGAGCCCCATCAATAACCCTGATGGCAGTAAAAATTAAAATTAAGT
TAAAATTTAAAAAGCACAATCTTCAGATATGTTTCTCGTGGAATATACAATTGTGAATGA
TGGCCTAAGTAAGACAGTCATACTTAAACTGAAACCAAAAGAGGTATTTCACAGTATTTT
TGTCATTTTTTTTTTGCTACCTAGGTTTCAGGTCTATGAGATTCTAATGTGCCCTGGGGT
GGGCTCCTATTATTCTTTCCATCACAGAAAAAGAGAGAGAGCAGTCAGTGATGAGCAACA
ATCACCATCTTTCATTTGAGCCTCACGGCCATGAGATCAACCCCATGCACCGCTCTGAGA
CCTCCGGCCCCCGCCCCTGGGCTGTGGGCTCACCTGCCAGCGACCTTGCCCACTGCGCCA
CCCAACCCCGGGGCTGGGGGCGGCCAGGGCTGTGCTTTGCTGGCTTTGTCCTCCTGACGC
CCCGATTTCTCCCCCCACAGGCCAGAAGGTGGTGGTGGTACGCTGCAAGGGCATCAACAT
TTCTGGCAACTTCTACAGAAACCAGCTGAAGTACCTGGCCTTTCTCCGCAAGCGGATGAA
CACCAACCCCTCCCGTGGCCCCTACCACCTCCGAGCCCTCAGCCACATCTTCTGGAGGAC
TGTGCGGAGGATGCTGCCTCACAAGACCAAGCGGGGCCAGGCTGCCCTGAACTGGCTGAA
GATGTTTGACGGGCGGGTGGTGGTGGCCGCTGCCCTCAAGGTTGTGCGTCTGAAGCCAAA
GAGGAAGTTTGCCTATCTGGGGCGCTTGGCTCACGAAGTGGGCTGGAACCAGGCAGTGAC
GACCACCCTGGAGGAGAAGCGCAAGGAGAAGGCCAAGATGCATTACCGCAAAAGAAGCAG
CTCATGAGGCTACAGAAATAGGCCGAGAAGAAAATCTGCAAGTTCACAGAGGTCTTTTAA
GACCCACGGACTCCTGGTCTGAGCCCAATAAACTTGACTGTTTGCTTAAAAAAAAAAAAA
GAGAGAGAGAGAGAGAGAACGAACCATAGCACTGATCCACCTCTTGTGTGTGGTGCTCCC
ATATGGTGGTCAGGGACTTGAACCTAGGTGACTGCACATATTTATCAATGAGAAAGAGAG
AAAGGAAAGGACCAGAGCATTACAAGGTGCATGCAGTGTCAGGGATCAATTCAGAACCTA
GTATCTATGAGGACAATGCTTTATCCACTGTTCTACTTCACTTCCTGGGCAACTTTTTTT
TTTTTTTTTTTTTTGCCAGCAAGGTTTCCCTGGGGCTTTGTGCCTGGCATGACACCACTG
CTCCCAGAGAACTTTTTTTTTTAATTTTTTTAATTTATTTTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved