Erinaceus_europaeus Locus Mono:73:SNORA2
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:73:SNORA2
Erinaceus_europaeus
Mono:73:SNORA2
scaffold_82604
SNORA2
1001..1139
2139
TTGTCTGGGCGCAGCCGGCTGGCTGGCTGTTTAACCAGGTGGAAACAGCAGCTCCATGC
CTTGCCTCCCACCCGCTGGCTCTTCCCACTGGCTGTTCTGAGTTCGCCCGAGCGAGTGGA
AACCACAGAGTGGTCCAGAGATAAATGTTCCAGAAACAGCAAAACAGTCTCGTAAAGAAA
GGGCAGAGGTCTTTGGAGATCTCTTCACAGGCAGAAGAGAAGGCCATAGTACATAGGTAG
CCAAATTGTCTTTACTTATCTGAGAGATGCGCAGGTCAGGTCCACGTGGGCGCCATTTGT
TGTTAAAATTCGGAAGGCTCTTGCCGTGCGGGTTGGCTTCGCGGGCGGGTAACAGAGATG
CGGAGACAACGGCTGGGCAGGGAAGCCGTATTTCTTTATTCAGGAACAATGATTCATAAA
CTAAGACAAACTAATCACCAAACAGAACTCTGCTGTCTCTTTGCGGCAGCGCGAGCACTC
TTTCTTTTACTCTCGAACTCAGGAACCCTCTCCCTTACTCTCGGACTCAGGAACCCTCTC
CCGGGGTTCCTTCGGCGGGGCCAAGAAGGCCCGCAAAATTAACTGGACTGATCCAATTCT
CTTGGTGGGGGAGGGCTAGAACAAACCAATGTAAAGCATACGACACTGCAGTATCTTTTC
CTCTGTATCTGAAAAAAGTCAGCCTAGAGTGATGAGGCCCTGGCAATAGTAATAATAATG
AGAAATGGAAATTGGGCATTCATCAGTGTGATGCCCTGGGTTCATACTCTGTTACCACAT
AAAGAAAAATCATGGTTGTTGTGAAGAGGGAGTATTTTCCTATGATGGGTTCTGAGCCGT
GAGCAAGAGTCTTAGGCTGGACAGCTTTCAGATTCTAGATTGTGGGTCTCTGAAGCTCTC
CTGCTGTCTTTTTTTTTTTTAATCAGATAATTTAATAGTACAGGAACATATACATCTCTG
TGGTTCATGCTGTAAATTTTTTCTCATTACAAAATATGTTTTCGGCCCGGAATCAAGGCC
AGCAGTCGGCTGCAGCTGTTGGTTTCAAACAGGAGCCTAAAGAAACTGCCTTCCTCTGGT
CTGTTGGCCATTTCAGCCCTTTGCGAAATGAAACGGTCAATTCATTAGGAAGAAACATCT
GGACAGGGGCTGGGTGGCGGTGCACCTGCTTGAGTGCGCGCATAAGTGCGCCAGGACCCG
GGTTCAAGCCCCCGTCCCCACCTGCAGAGCGGGGAAGCTTTGTGAGTGATGAAGCAGGGC
TGCAGGGATCAGTCTCTTCTCTCTCTCTCTCTCCCCCTCTCCTCTATCATAATCTGCCTC
TCAATTTCTCTCTGTCCTATCAAGTTTTAAAAAGGGGGTTAAGCAGCACGTGGCACAAAG
CTTAAGGATCCTGGTTCGAGTCCCTGGCTCCCCACCTGTAGGGAGTTGCTTTCTCTCCCC
CTCTCTCTGTCTTCTCTCCTCTCTCCATTTCTTTCTATCCTATCCAACAACAACAACAAC
GATAATAACTACAAAGGAAACACCAGGACAGAATAAGAGAGAGACACCGACCCCTGCAGC
CCAGCTAATACCAGGGGAAAAAAAAAAAAGGAAAAAATAAATAAATATGTTTTAATGACA
CCGAGAACTAAACCAAGGACCTTGCCATGTGCATGGCACTGTTAAGTAGCCTTGTTATTT
TTTATTTCTCTATAGTTAGAGAAGACAGACACTGAAGCATTATTCCACCAACCTTGGAGT
TTCATTTGGTGCTGTCCTGGGGTCTTATCCAGGTAGTGCTAGGTATCAAACCCAGGACGT
CACACCTGGCAAGGTGTGCCCACTGAGCTATCTACCAGCCTGAACATTAACTTTTAATTT
TTATTTTGTTTATTTTAGATATATAGAGAAAATGGGCTAGAGGAGAGAGAATGAGAAAGA
GCGATGGAGACCTATAGCACTGTGTCACTGCTTGTGAAGCTTCTGTCCTGCAAATAGGGG
TCAGAGATTTGAACCCAGGTACAATTAAACTGTAATGTGTACACTCTGCTGATTGTGCCG
CCGCCTGCCCCATATAATTCTTCTTCTTCTTTTTTTTTTTTTTTTTTTTTTGATAGAGGC
AGACTAATCAAGAAAGAAGGGGGAGATAGAGAGACATCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved