Erinaceus_europaeus Locus Mono:344:SNORA26
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:344:SNORA26
Erinaceus_europaeus
Mono:344:SNORA26
scaffold_318067
SNORA26
1001..1125
1360
GGGCTAGAAGCTGGATCAGGGAGGGGAGTAGCTCCCGAATATGGGCGGATAGAAGGGTA
AATATTGCTGACTATAAGCCCCATTGATTTACTCTGGGTCCCATATTCAGCACAGGATAA
CTTGTGTAACCTCTGCATCCCTGTAGGTCTAAGCTTGCAATCTGTGCTCATGAGTAGGAA
CGTTCCAAGATGCCCCAAATTCAGGACCCATCTTCCTTCAGAGGATGGAACATTCTTTAC
CATTGTTGATTCACTGATGCAGTGCTTTAAGTGGCTAACACAGAAGGGGAAAGTAAATCT
CCATAAGATCCAGGGAAGGGATTGCAAAACTCTTCACTAAATTCTGTCTGGAGTTGCAGT
AAAAAAAAAAAAAAAATTTGACAGAGACAGAAATTGAAAGGGAAAAAGAAGATAGAGAAT
GCACTACTTGTGGAGTTTTCCCCCTTAGGTAGGTGAAGCCCAGGGACTTGAACCTGGGCC
CTTGTGCACTTTCATATGTATACTCTACCACGTGCACCATCACCTGGCCCTGGTGGGTTG
TTTTTTTAAACTCATCTTTGTGTTCAACTTCCTGAGTCTGATGACCTCTGAAAATCATTA
CCCTGCTGAGCTGCTCAGCTGAGAAAGTAGACTCGTTGCCTTTTCTTGTGTGCACTGCCC
ACAGGCACAAAAAAGCCATGCTGTTCCACCTGGGGTGCCCTAGGGGTGTTTACCCCTCAC
CAAAGACACAGAGCTGCTTCAAAGGCATAGAAAATAAGAGGCAGCTGGAAAGATATGAAA
TGTGATCAGGAACTGGAAAGAACTTTCAATATAAAGGCACTTTAAACAAATTAGTCTTCT
GTAAACTGGATGGGTAAAGGCAGGGAAGAGGACCTGCCAGGCAAACACAAACATGTCTGA
TTCCTTAAAATGCTGCTAAACTGAAGCCTAGGAAGAACAGAGAAGCTTGTGGATGCTAAA
ATAAAACAACAACAACAACAACAACAAATGAAGCTTGACTCTATAGTAGAGAATCTGCTA
ATCAAGAGGCTACACATTAAAAATATGTAGTACAGGGCCAGGGAAATAATTCACTTGGAC
CGTGTGCATGTCTCATATTCGAGCCTGTCCCCACTGGTGTGTGTGTGTGTTGTGTGATTT
TCTAAGGCTCAGGATGCATATCTGAATGGGCCCTAGAGCATCAGCATTACAGAGGTCAGC
ATCACACCATGCCAGCGACCACACTGTTTAGTAGCTCATGGATGGCCCAGACTGCAAGTC
AGACAGTAGTCCTAAGACCTTATCAGGCCTCCAGACTTGGACATCCATGGCTCACCTTCC
CTGAGGCCCCTTGATGAGGCGTCAGGGCCATCAACACAAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved