Erinaceus_europaeus Locus Mono:170:SNORA1
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:170:SNORA1
Erinaceus_europaeus
Mono:170:SNORA1
scaffold_316949
SNORA1
1001..1123
1731
CTAGATTGCCAAGTATATTTGGTCTAATTGGTTAGAGAATTTATGATGCCTTCTTTAAG
CTATTTAACTGACACCCCAGGATTATTAGGTCTAAGTGTAACCATGAAATTTTATAATTA
GAATTTTATAATTTTTTCTTGCTTATGAATACATGTACACCTGTGCGCAGTACCCTAAAT
CCTAGTCTGTATCTAGTATCTGTGACTTTGTTAGATAATGTGCAACCTGAAATCTGAAAC
TAGGTAGTCCCATGTGTTAGGAAAGATCTCTCCAGATTAGAGGAGTTGGAAGGTTGACAT
CTCAGTTTTGGCATCTCTGGTGACAATTTGCAGTAACAAGTTAGTAGAGGCATAACATGG
CCTGGCAGGACTGGTAGCATTGATTTAGTTGAGGTCAACAGGGGCAGTATGATGGTAAGG
GATCAGAGAGAAGAAACATCAAGAAATGTGGGCATTGTCCTAGAGGTTCCAGGACTAGGG
GAAATAAAGATCTTAAAGAGAATGGGAAGGGTTCCTTATTGTCTTAGAAAGAGTTCAAAA
TAGCAATAGTTAATTCCTATTATAAAAAAGTTAGTTTGGGAGTTTGTTTTTCTATGAAAA
TCCAGTGAAAGCCTCATTCTAAATAAAAATGGGCACTGTTGCTTTTGGTGAAATAGATGT
GGCTACATTGATACAAGTTAAGCTTCCACCACAGCATCTATTGCATTGGTGACAATGAGG
CCAGCAACATGTTTATAAAAATTTAAAAAATAATAAAAAATAAAAATACTCCTAGCAAAA
TGTAGACATATAAATCAGTAGTTAATTAATATGAGAGGGGGAAATCAATTGTATGTCTCA
AAATTTCTCAAAAGACAAACAGAATCTTTTTAATATATAGGCTGTGTATTTGATATGCGG
ACTCTCTCAAAAGCCTAGACCAAGTAGATTAGAAGCATCCAATAGCACAGCTATATACAA
GATACTGGGTACTGTACAGCAAACCATAACAAAGGGACTTTTCAAAGTTAACCCAATTAA
CAAATAAAGTGATGATAATATTAACTATCGATTGTCTTTTCTGAACCCTAAGACAGCAGG
AACCTCACATCTTTACTATAGAGCCCCTACTTCCCCCAGCCCTGGAACCCTTTGGATAGG
GCCCAATTTCCCGTATGCATCTCCCAATCCGAACCAAATAATATTGCATCCGCCGATCAC
AACCTAACCAAAGCAACGATTGCCACCTCAATATGCTTCACCTCAGACTGTATCCAGAGA
CTTCACGTGTGGAATGACAACCCTTCAACTTCATTACTCGGGTGAGACCTTTCCTTTTAT
AGTACACTCTAATTTCATCTCAGGTAGTTCACTTTCTAACAAAGTCCCATAATCTAGATA
AACACCAGTTTCTGTGAGAGAGAGCTTTTTTTTTTTTTTAAACAGAGCACTGCTCAGCTC
AGCTCAGCTCTGGTTTATGGTAGTGCTGGGGATTGAACTTGGGACTTCAGAGCCTCAAGC
ATGAGAGTCTCTTTGCATAATCATTACACTACTACCCCGCCCCATTTTTCTTTTAATTTG
ATAGGACATAGGGAAATTGAGAGGAGAGGGGAAAACAGAGAAAGAGAGAGAGAGACCTGC
AGATATGCTTCCCCACTCATGAATCTTCCCCACCTGCAGATGGAGACTGGGGGCTTGATC
CTGGGTCCTTGCACACGATAATGTGTGCACTCAGTGGGGTACAGCACTACCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved