Erinaceus_europaeus Locus Mono:339:SNORA62
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:339:SNORA62
Erinaceus_europaeus
Mono:339:SNORA62
scaffold_345839
SNORA62
1001..1157
2157
AACCGGGAAACTCAGGAGAAGACCTATACCTCGGTGGCATAGCTGAGGGGCTGTGAAAG
TCTCTTTGCATAACCACTGGATTATCTCTGCCACACCATGCTTTATCTCTTGGTTAGGAG
TCAGTGATTAAGCCAAGAAGCCTATTGATAGTTTAAAAGCCCTCAGGCTCCCATAGTCTA
CAGGGGGAAAAAAAAAAGGCTTTTACACCACTGAACTCCAACTCAGGGATTGAAAAACCT
CTTAACTTATATAAAATGGTTAAAACAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGCATAAAAACCTTCTCAGACAAGCAACAGTTGAAAGAATCAACTATCACAAGCCT
TCCCTGAAAGAAGTTCTGAAAGGTCTCCTATAAACATTCAGACCACTATAAATATGCCAT
ATATCATAGCACTCTAAAAATCTACAAAAATTGTGTTAAAGTATTTTCAATGTATAATAT
CAATAAATGCCAATGGCCTCAATTCACCTATGAAAAGGCACAGAGTAGGAATATGGATCA
GAAAACACAACCCAACAATATGCTGTCTACAGGAAACCCACCTAAGTCAACAAGACAAAC
ACAGACTCAAAGTGAATGGATGGAAAACTATCATACAAGCCAATGACTAACAAAAATAGG
GCAGGAGTATCTGACACGATAGACTTAAAATAAATAAAATTTTAAAAGATAGGGATGGCC
ATTATTTAATGCTCAGAGGATCAGTCAACCAAAAAGACTTAAGAATTATTAACATCTATT
CACCCAATGAGAAGTAATATAAATACATCAAACATCCATGGAAAGAGCTACAGCAATATA
TTAACAGCAACAAAGTAATAATAGGGAACTTAAACATCCCACTCTCACAACTTGACAGAT
CATCCAGCAGGAAAGTCAACAAAGAAACAAGGGAGCTCAAGTGTAGGTAGTGTGCTACAT
GAGGGCCAAGTTTTTCGCTAACACCATGAGGGTCTCTGGCCGAATGAGTGGAGTTGGATA
GTAATTCTTGCTACAATATGTAAAATAAATAAATAAAATAAAATAAAAGAAATAAAGAAA
CAAGGGAACTAAATGAGGATATATATTAACTAGAAGTATTGGACACTTTCAGAATCATTC
ACCCCAAGAAACTATAATACACATTCCACTCCAGTCCACATGGGTCATTCTCAAGGATAG
ACCATATGTTAGCCCACAAAGACAGCATCAGCAAATTTAAGAGCATTGAAATCATCCTAA
GCATCTTCTCAGACCACAGTGGAATTAAACTAACACTTAACAATCAACAAAAGATTAGTA
AGAGTCCCAAAATGTAAAAGCTCAATAGTATACTACTTAACAACTACTGGGTCAAAGAGG
AAATAAAGGAAGAAATAAAAAATTTGGCGAGTTCAATGAAAATGATCTCACAACTATCAC
AATATTTGGGACACAGCTAATGCAGTACAGAGAGGGAAGTTCATAGCCATACAAGCACAC
CTGCCGGGATACCTGGCACCTCCCCCGAGATGCCTCTGACCAGGAGAAGAAACTGCAGCC
AAAGGGAGAAATGTGCTCAAAGTCCCTTGCTTTTATACATTTTTTATACACCTCCTCAGG
TGACATCATTTGTATGCTAATAGTCCCAAACTCCTGTTGAGGTCACTGAAGATTTGCTTA
TTTCTCCCATGCTCATACAGACTGTACATCTTGTTCATGTCTATAATCAGAANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved