Erinaceus_europaeus Locus Mono:438:SNORA73
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:438:SNORA73
Erinaceus_europaeus
Mono:438:SNORA73
GeneScaffold_8155
SNORA73
1001..1197
2197
TGCAAACAGTATGGGGATTTAACTAAAGATGGAAGTAGTTTATGATCCAGCAATACCAC
TCTTTGGCATATATCCAAAGGGCATGAAAACACTAATTCAATAATAGGAATCCTTATGTT
CATAGCTGCATTATTTATAATAGTCAAGGAGTAGAAGCAAACTGAAAGCCCACTGACAAA
GACACCTGGATACAGAAGTTACGGGATATATACTCAATGGAATACTACTCTGCAACTCAA
AAAAGATGTTCTACTCTTTGTGCCACAACAGATGGGGCTGGAGGTGAGTATGCTTAGTGA
TGTGATTAAGGTGAAAGACAACTACTGGGTGGTTCTGCTTTTCTATCAACAGAGAACTGA
AACACGAAGCAACAAGGGGGAGCAGGGGCAACCAAACTGCTTCTAAGACTTTCTGAGAAA
CTACAGTAATTATCCTTGGGTGGAAGCACAGAACTTTGGTGGTGGGTGGAGTATGAAATT
ATATTTCTGCAGTTTTTTATTTATTTATTTATTTTTTTACCAGAGCACTGCTCAGCTCTG
GTTTATGGCAGTGTGGGGGATTGAACCTGGGACTTGAGAGCCTCAGGCATGAAAGTCTCT
TTGCATAACCATTATGCTATACCCTTACCCTCATTCCTGCAGTTCTATAGTCCTATAAAG
CACTATTTACTAATAAAAAAAATCAGTAATAAGAAAACTCCCAAGTCCAGTTCAGATACC
AGCTTCTCTAACAAGGCTTTCCTATTCCCCAATGATGTAGTTACTTCTGTTATTCTCTGT
GATAGCTCCAGAAATTACACATGATAAAAATAATACCGGTCACTTTCTATGTTGCATAGT
GTTCTAAATGCTTTACATATATTAACTCATTTAATTTTCCCCACAATGCTAAGAGACAGA
TGCTGTTATTATTCAGATTTTGAGATTAGGAAACTAGAACACTAATGGTAAGCAACTTGA
GTTGCTTTCAATCCAGGTTATTCTTAAAACATATTGTTGGGCCAATGCGGATACCCTGGG
GGTCGCTCTCCCAGGCTCTGTCAGGTGGCAGTGGGAGTGCAGGGCTCTGCCCTGTGATGT
ACAGTCCCTTTCCACAACATCTGAGATGAAGCTAGGCCCCAAGTCCGCGCCTGCATATTC
CTACAGCTCAGAGTCCCATGGACCGTGACTGAGGAGATAAACCATGCAGGAAACAGTTTA
CCTGACACCTGCCTGGGTGTAGGCTTTTTTTTTTTCCTTTCCTTTCCACTCTATAAGTCT
CTGATTTAAGCTCTGTTTTGCAGCTCTCACTGGGAATTCCAGGTGGCTGGCTTAGAGCTC
TCACGGGGAATTCCAGATGTCTGGCTTACAGGGGAGATGTCTTCACTTCCTTCAGTTACT
TCGACTATATTGGGATCCTTTATCTGGCAGGTTGCACAGTGAATTATGAATTGAAAGTGT
GTCAAGATATAGCTCACTAGTACAGTCCCTGCTAGTACAGCCCTCGCACTATCACAAATG
GAGGGCAGGACTCTTAACTGGGAGACAGAGCAGCAGGTGCCTACTAAGAAGGGTAACTCT
GGGAACTTAGGTGTCTTTCAGGAGCCAGGGAGGTGCATCACCCAACTTAGTGCACGGGAC
CCTTGTTCCCACTTGCGGGGTGGGAACTGAATGTCTTTTCATTTCAACCAAATTCTAACT
GTATAAATAATAAATGAACAGATCTGTGTTTCTGTGATTGCCAAGCCCAAATAAAAATTA
AATTTTTATAGATTTTAAAAAAAAGCATACTGTTGGGTTGGGGAGATAGCAAAGTGTTTA
TGCAAAATACTTTCACGCCTGAGACTCTGAACCCCCTGGTTCTATCCCCAGCATCACCAT
AAACCAGAGCCAAGCAGTGTTCTGGTAAAACAAAACACTTTCCAGCTTATGATATAATGG
AGGAAAAAACCCCACATCCTGCCATGTATTTTTTAATAAAGATATTCTATTTATTTGATA
GAGGCAGAAATTGAGAGGGAAGAGACCTGCAACACTGCTTCACAGGCTGGGAATCAGGGG
CTTAAACCCAGGTCCTTGTGCATTATGGCATGTGTGCTCTACTGGGTACTACCTGGACCC
TTGGCATGTTTTTATTGCCGCAGTAGATGGCCCATGTTGCCACTGACCTGTTTCCAAGTC
TTCTTCATTATGTGTTTTTTTTAAATTTTTTTTATGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved