Erinaceus_europaeus Locus Mono:353:SNORA25
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:353:SNORA25
Erinaceus_europaeus
Mono:353:SNORA25
scaffold_214937
SNORA25
1001..1123
2103
CAAGGACCCCCCAAGACTCCAAGTTTGAGCCTCTGGTTCCTCACCTGCAGGGGAGTCAC
TTCACAAGCGGTAAAGCAGGTCTGCAAGTGTCTGTCTTTCTCTCCTCCTCTCTGTCTTTC
CCTCCTCTCTCCATTTCTCTCTGTCATGTCCAACAACAGCAGCAGCAGCAGCAGCAACAA
CGACAGCAGCCACAATGGGAAAAAGACGGCCACTAGGAGCGGTGGGTTTATAGTGCAGGC
ACTGAGCCCTGGAGGCAAAGAAAAAGACTAAGAAAATTATTTATTAATATTGGCAAAATA
ACCACTTAGATAGTGTGCTGCTTTGCCATGTACAGGACCTAGGTTTGAGTCTGTGTCCCC
TGAATTGAAGGAAACTGGTTCTGTGGATTCCCTTTCTTTCTCTCTGCTTTCACCAAACAA
TAATAATAATAATAACAATAAAGAACCAGAGCATTGCTATGGCACATGTGCTGCCAGGAA
TTGAACTCATGTTTGTAAGTTCACCACTCTACCCTCTGTACCACCTGTGTGAAGTCTGCT
TTCCAAAGGCCAGGATGTTTCAAGTCCATGTACAATTGGAAGCATCAGCTCCTGGGTTTG
GAAAGCTCTAAACAATCTGGAAAATGCATCGTACCACACACTGAAGCAAAAGGAATCTGC
TTTGTTTGTTTTCCCTTTCTTTCAAAAAGCCAACCAAAAAGAATCACGAAAGAGCAAAGT
GGTAGGATTTAAACACATTGATAATGGAACAGAATGAAGAGTCCCGAAACAATCCACACT
TGTAGGGTGCAGTTAATTCTGGAAGTGGCAGAACAGAGCAAAGGAAGAGGACTTCTTTTC
AGTTAAAGGTGCTAGGCCAACTGGATATCCCCAGTACCACCATAAATTAGAACTGAGCAG
TGCTCTGATCTCTCTCTGTATCTTTCCCTCCTTATCTCTCTCATTAAAATAAATAAAATC
TTTTTTAAAAAGGAAAAAAATAGACAATTTCAAAGAGAGCTTTTGGACTAAAACCAGGAG
CTCTTAACACTGTGACCAAAGATCAAGTTCTCCCTGAGATGTGATCAGCACTGAGTAGTG
CTGTTTTCTTGGGATGAGATAAGAAAAAAAAAAAAAAAGACAAACTCAAGCCCGTACATT
TCATCCCATCCCATATACATTCTGGGTTCTAAGACTGTAGCTCTAAGTGGGAGGAGTAAG
TTGAAACTTGTTAGGAAAAAAAAAAGAAACTTGTAGAAGGCATACATCATGACCTTAGGA
GTAGTACGCCTTAAAAGAGATGCCTGAAATGAGTGGGAAAAGACTTGTTACTGGCAGTCT
TATCTGTAACAGCCCTGAAATGGAACCAATCCAAAGCACCATTGATATAACACAATGAAT
AAATGCATTTTATAATGAGAATAGACACAACCTTCTTTCTGGTGATACTGGGACAGAAAT
AGCAGGAAATGTAGAGTCAAAAGTCCAGGCAGGGCCTGGGAAGGTAGCATGATTGGAACT
GCAACAGACATTCATGCCTGAGACAATAGAGACCTCAGATTCAATTCCTGACGCCGTCAG
AAGTCAGAGTTGAGCTGTGCTCTGGTAAGAAACAAAACAACAACCAAGTAGACCTCACCT
CTGCTCCCCCCTGAAATGCCAGATCTCCCCCAAATGGGCCTGTGTGGTTTTCAATGTTAT
ACCAGGATAGAGTAGGGGAGGGGAGGGGAGAGAGGTAAGGAAGTTCAGGACTTCAGAATT
CCTGTCACTTCCTCCATGATGAAAATGATTGCCGGTCAGCCCAGAAGATAGCTCACCCCG
GAGGGTGCCTGCTTTGCCATGCTTATGATCCAAGTTCAAGCCTGGCCCCTTCTGTACCGG
GGGAACTTGGTGCTGAGCTCTATCTATCTGTCTATCTATCTATCTATCTATCTATCTATC
TATCTATCTATCTATCTGAAAAAGTCAACCTGCAGCAGTGAAACATTGGCAATAAGATTA
AAAAATAAATAAATAGTTGGGTGGTGGAGCAGTGGGTTTAGCGCACATGCCGCAAAGCAC
AAGTATGGGCGTAAAGATCCCGGTTCAAGTCCCCAGCTCTCCATCTGCAGGAGGGGTCGA
TTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved