Erinaceus_europaeus Locus Mono:408:SNORA57
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:408:SNORA57
Erinaceus_europaeus
Mono:408:SNORA57
GeneScaffold_5853
SNORA57
1001..1148
2148
CCCTCATCGACTCCCCGTCGGGAAAGATCTGAGGGCTCGAGAGAGAGCATGGGGGACAA
GACGCGGGCTCCCACTGTCACCGTTCGGGGTCGGTTAATCTTGCCGCCGGGGCCCGCCAT
GGCTGCACCGGGGACTCAGGGCGCAGGTCTGTGTTTCCGCTGTGATTGTGGAAGCCACGC
CCCCTCTGTCCTACTATAGGTGGATTAGGGACCACGCCCCCTCCGCCCCACGTAGCTGGT
TTGTCCAGCCACGCCCCCTCCGCCTCGCCGTAGCTGGTTTGGAAACCACGCCCCTTCATC
CTAACGTAACTGGTTCTGGAAGCCACGCCCACCGATCTGTCTCACATAAACCAATCATAA
CGTGGGGGGCGGACCTCAGGTCTATATAAAGGCACCGCGCGCTAGAGATAAGTCACTGAC
GGATTTTCGGAAGAAGCTTCTTGAACATAAGGAGATAGATGGCCGTCTCAAAGAATGTAA
GTGCACCTCTTCCTGCAGAATTTTGTGACTGGACAGGCTTCGGTGTCTGACAAAGCGGAG
GCCTTTCGCTGAGCTCGGCCACCGCGCTCGGGGAACGAAAAGGCCTCGGTCCAGGACAAG
GCGCTTTGTCATCCTGCCCAGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCCCCTCCGCCCCACGTAGCTGGTTTGTCCAGCACGCCCCTCGCTCGCCGTAGCTGG
TTTGGAAACCACGCCCTCATCTACGTAACTGGTCTGAAGCACGCCCACCGATCTGTCTCA
CATAACCATCATAACGTGGGGGGCGGACCTCAGGTCTATATAAAGGCACCGCGCGCTTAA
CTAAACCCTTTCGGAGTCTCCAACCTGTGAGTGGATGGTTGCTGTATTGCACCTAAGGTT
CCAGGCGGGGGGCGGGCGCGGTTTTATGCGGGCTTATGCACCCTCCTTTTCTTGGCGGGT
ATCGGGTTGCAGTCCCGTTCCCCGTAATGTACGGAGGCAGAGGGCAAGGGCTTCGGGCCC
CTCGGCGTCATGTCTTCGGTGCCGGCCGCTTCCAATCCGCCGGTTCTATCCTCAAGCACC
GAGACACGGCAATTTGGGGACAGGGGAGGCAGCGGGGTCGCCGCGCGCCTTATCCTGGGG
TGCTCACGCCTTCTCTTTGCAATTTCAGGTCTTTGGAAGACGCCTCCGCAGCCACGATCG
ATAGTGCCCTTCTCTCCTTGTTTTACTGTAACTAATAAAGGTCATTGCTACTTTAATGGC
TGTGTGTCCACGTGCTTCTTTACGAGCCTGCGGTTAGAACTGTTATTCTCGGAGTAGGAT
TTGCAGAACTTAAACGTGGACGTCACGTTTTTACCGGGTTAGTGCGACCTTGCTGTGACC
CGGATGGCTTTGCTGCGCCGAATCTTGCGTACGGAAACCCTGGCGGCAGGGGTGCGCCTC
ACCTCGTCGGGGAGTGGAGGTGGGTGCCTCTGTCTGATCTTTAACAGCCCCCACTCGTTC
GGGGGACGTTGCAGTCGGTGACACCTGCCCTCCCCTCGTGCTTACAGGCTCCCTAGCTGG
TAGATGCCTGGCCGACCGCCAGCTCTGGGATGAACTTCACTCCCAGCCCCGTTCCAGCCA
CACCCCCACCTTCGACTGGTTCTTTGGATACGAGGAAGTCCAAGGCCTCCTGGTCCCCCT
GCTGCAAAAGCCATGGGTTACCGATCCGGTGCGGGTGCTGGACGTGGGCTGTGGGACCTC
AAACCTGTGCACAGGTCTCTACACAAAGTACCCTCACCCTGTGGACATCTTGGGCGTGGA
CTTCTCTGCTGTGGCCATGGCACACATGGACAACCTCCTGGCAGGTGGCCACGGGCACAA
TGCTTTGTGCCCTGCACACCCTTCCTCCCGCCTCAGTTTCCTGCAGGCTGATGCCCAGAA
CCTGGAATCAGTGGCTCCCTCCGGGTCCTTCCAGCTAGTACTGGACAAGGGCACCTGGGA
TGCTGTTGCCCGGGGTGGACTGCCTAGAGCTTGCAAGCTGCTGTCAGAATGCTTAAGGGT
TCTGAATCCTCAAGGGACCCTGATTCAGTTCTCAGACGAGGATCCTGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved