Erinaceus_europaeus Locus Mono:491:SNORA44
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:491:SNORA44
Erinaceus_europaeus
Mono:491:SNORA44
GeneScaffold_2963
SNORA44
1001..1110
2110
GAACCAGTGCTTTCTTTGCACGCACGCATGCACGCACACATGCTGTAATGTTAGTCTAT
GAGAGTATTTCACACCTTTTTATGTTGTGTATTACATCATGCCCACCCAAGTACCAATAT
CCCTCAAGAATGAGTATTTTCTTTTTAAATATATATTTTAATTTTAATATTTATTTATTT
GCTTGTTTTCCTTTTTTGTTTACAACATTGTTGTGGTTATTGATGCCGTTGTTGTTGGAT
AGGACAGAGAAATGGAGAGGAGGGAAAGACAGAGGGGGGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAATGGGTTTCCCTGCTATGTACTTCACCTCGCTGGTTGG
GCTGTTGACCACCATGCCAGTGCTTTCATCCCAACCTGGAGTGGAAAAGAAACAAACAAG
TGAGGTGGAAAATCCAAGTGACTTAATTTGATAAAAAAAAAAAAAAAAAGGTTAAAAAAT
ATATTTTTTTGCATGCAAGAATAACCTGGAGAGACTTTCACAGAACAGGTCAGCATAATA
TCTGTAGCTGCCACTCAACTTCCCTATATTTCAGGAACATGGGCTTTGATGCATTTCTCT
TAGATTTTCAACAGTTTGGGTTAGAATGAGTATAAGAATTAAAAAAAAATTTAGTCTCCT
CTCCTCCCCTCCTTTCCCCTCCCCGCCCCTCTCCTCTCCCCTCCTCTCCCGGACCAACTA
AGAATACCAAAGGAGACCACCTGGGACTGAAACAAGACAANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCGGGTTTGGCTTCCCCTGAGGCTTCTGCTTTTCTGACCCCACCACCTGCTGAT
ACATCATCATTAAGAGACCTAGTGGCTGAGGTACGGAAGTTAAAGGCAGCATTTAAGGAC
TTTAAACTATGTGCAGTCCACCCCAAGAGCTCCGTCCCCGTAGATATGTGTGCAGTTTCC
CCTGCGGCCACTACAGCAGTTTCCACGGCACCTTCCACTTCTGTAGCTCCCTCTCCCGTG
CCATCAGACCAAATCCACACCTTCCTGGTAAATGTGGCCCCTTCTGAACAAAACACTCAG
CCGTGGCAGCCATACTCCTCTAAGAAATAGGAGCACTCAGTCAAGCGGTCAGGGAGGATG
GTTTGCATGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved