Erinaceus_europaeus Locus Mono:411:SNORA30
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:411:SNORA30
Erinaceus_europaeus
Mono:411:SNORA30
GeneScaffold_4974
SNORA30
1001..1131
2131
CAAAATATTTATTTTTTAAGACATTCCACCAAACTCTAAATTGTTAAAATGTCAAAGAT
GTGTGATGAGTATGTTCTTCAAACCTAACTCCTGAGATAGAATAGCACATAAAAGAATGT
GTAGAGTAGCATCTACTGCTTAGTCTCTCTGGAGCATGTATCTTTTCCTTAATTGCTTTA
TTATTTGGGAGGCCAATGAAACATTGTTTGGGCTACATGCTATCAAGCATTAGTTAACTA
TTTATTGTTATTCAAATTATATATTTTGTCCTACTTGAGGTAATAAAGTTAGTTAAATGA
GTTGTAGACTTATGGCCTGTTTTAAATGCTGTTTCATTGTTTGCATTTATGCTTTCAGTT
TCTGTGACTTCCTATAACACACATACACACACACATACCACATGAATAAGTTAAAATGCT
GTTTAGCATCTGACCATGATTCTGATCTTTTACTCCCGTGTTTTCTGGATAGTAATTAAA
TAAGCTGAACCTCCACTTATTAAAGAAAACAAAACTTACCTTATCTTCCCATTCATTGTC
CAAAAAAGCACAAATTCTTACTAAACAATCAGCTATAACATTCACAAAGATACATCAAAA
CCAGTCACTCATCTCCAGGTTTCATACTAAAGTATTTTTTTCAGCTTAACTTATTTTCAT
GAAAAAGATGCCAGAACACCATGCTATGTGAGCCACAGATAAGACCAGGGACCTCTCACA
TCTAAGTCTTAAGTACCTAGCCTTATTTATGTCCTGCATAAATATAATAGAGAATGTCCT
GGGAAGCAGAAATTCTGAATCTGTAAAGGCTTCCAAGAATAATGCCATGACTTAAATTTC
ATAAATGGATATAAGTATGAATATTTTCATTTATGAAAGATATAGTTCATAAACTATAAT
CCAGATCCTAAGAAATATACCATTGAAAGAACTTAAAGAAATATCAAAAACTCATTCCAT
TACAGTCTTATAATCCACTATCAGTCACAAATTAAGAACTAAAAAAACTCATTCTATCTC
CTCCCCTAGATTGTGGGGATAGGATTTGTTAGCTGGTACTGAAACAAAATCCTTGATTGC
ATTCTTGCCCTGGGTCTGAGCTAGTGGCGGCTGTCAACTTGATGGAACACACACACAAAA
AAAACAAACAAACATTCTATCATTAAAGATTTAGTCTATTGTTCACAGAAAGCTCATATG
TCTCCCTTTCATGAACAATATTGGTGGGAAACAAATTATGACCATTTTGCATGCTATGGC
TAGTCTTTACTGTGTCTCAGTAAAATAAAGGAAACAAAGTTAAAAAAAAATAGGAAATGG
GCATATCACAAGAAAGGACATACTGTGAAGTGCTATGATTCTTCTTTTTCTCATATCTTA
AGAAAAAAGATAAACCAATAAGATGTTTGCTTCATTTAGAATGAGTTCCTCTTGGAATAG
CTGTTATTTCTTTGTTTTTTCAAGTTTTCCTTAGTTTTCAAGCCCCCTACTGGGATTAAT
TTTCTTTTAAGCCTGAAACATCAGTTTGGAGGTGTCCCTCTGATCAATCCCCCTTTTCCC
CAGGTGTAGGATTTGTGTTTGTAATGACAACTAGCATGGGGCTTTTAAAGCCAATCTCAT
GTACACAGTGATGCCTGCAACCAGCAGTGCAAATTCACTCTCTAAGCTTTCTTCCCATAA
GCAAATAATAAGGAGTCTCTAAATCAGATGCCTTTGTGTGAAACTAAGAGATGGATAGTT
TCCTGCTATACCTGGAAAACTATTTCTCCTACCACATTTTAGGGGGAAAAAAACAAAGCC
ATATAATCCTGACCAAGTCAGTAAAAATTTTCCAGTTGCTGAAAATTTATTTTTCTAACT
ACAAGTTAACCAGGTTATCTTAGTATACCTCTGCATTTACCACTAAAAAAAGAGAACTTT
GCTTTTAAATCTTTGCTGATTAGAAAAAACTTATTTATCTGGTTAAACTGGGACCTCACG
CATGCAAAATTTCATCACTCCAAGCCACATCCTTCAGTCAAAGAGTGAGTGAGAGAATGT
GGAATGGAAACTTCCTGCACTGACATCGCGCCACTCTTGTGGTAATGAAGCTCATATCAG
GGTCTGAAGAACGGTATTACAAGTAGGCTACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved