Erinaceus_europaeus Locus Mono:295:SNORA41
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:295:SNORA41
Erinaceus_europaeus
Mono:295:SNORA41
scaffold_151435
SNORA41
1001..1132
1808
CAAGTTAATAGGAGTGTACATAAACACCATTTCCACCACCAAAAGATGGTCCCACCCCA
TCACCCCCATCCCCACCCTCAGTGAAGCTGAGCATCCACCCTCACCTTCTACCCAGAGAT
TTTTACTTTGGTGCCCTAATTCAAACTCAGTCAGATCCTGCTTTGAGTTTCCCTTTCTGT
TCTTCTTTCTCAATTTCTGTTTATGAGTGGGATCATCCCATACTCATCTTTGTCTTTCTG
ACTTAGCTCACTTAACATAATTCCTTCTAGTTCCATCCAAGATGGGTCAGAGAAGGTGGG
TTCATTGTTCTTAATAGCTGCATAGTATTCCATTGTGTATCTATACCACAGCTTTCTCAG
CCACTCATCTGTTTTTGGACACCTGGGTTGCTTCCAGGTTTTAGCTATGATGAATTTTGC
TGCTATGAATATAGGAGTACACATATTTTTTGGTTGGGTATTATGGAATCCTTGGGGTAT
ATCCCTAGCAGAGGAATTACTGGGTCATATGGAAGGTCCATGTCTAGCCTTCTGAGAGTT
CTCCAGACTGCTCTCCACAGAGGTTGGACCAATTTACATTCCCACCAGCAGTGCAGAAGT
ATTCCTTTGTCCCCACAACCCCTGAGAGAATGGCATACATCCAAACTTTTTTCTTAACAT
CAAAAAAAGTTTTTTTTCCTTACAGCTACTGTTCTGCAGCTATCCTTATAGTAGCAGTTG
TGGCATTCTTCTGTGGAAAATAAATTTACACAATTGAAATAGTTCTTTCTTAGCAAAACA
GAAAGTAGACATGTGTGTGACAAGGTGTGTTGTAGTTTTTTTAAAATTTATTTATAAAAT
GGAAATATTGACTAGACCATAGGATAAGAGGGGTACATTTCCACACAATTGCCACCACCA
GAACTCTGTATCCCTTGACAGCTTTCTTATTCTTTATCCCTCTGGGAGTATGGACTCAGG
ATCATTATGGGGTGCAGGAGGTGGGAGGTCTGGCTTCTGTAATTGCTTTTCTACTGAACA
TGGGTGTTGGCAGGTCAATCCATACTCCCAGCCTGTCTCTCTTTCCCTAGTGGGGCGGGG
ATCTGGAGAGGCGAGGCTCAAGGTCACACTGGTGGGGTCGTCTGCCCAAGGAAGTCAGGT
TGGCATCATGGTATCATCTGGAACCTGGTGGCTGAAAAAGAGTTAAGATATAAAACAGAA
CAAATAGTCGGGAACCTAAAGGCAAGAATATTGCAGATGAAGATTTGGGGTCTCCGTTTT
GGAAAAAGCTAGTAGGTCTGTTTTAGGTATATGCCAAAGGGGCCATGACTTTACTAGTTT
TTGCCTGAGCCTGACATCTGATATGCAGATGGACCAGGTTATGTCTGGGGAGATGGTGTC
AATGTTGGAAATAGGACTAGAAAGCTATATCAGAGTAGCTCCCAAATATGGGGGGAAGTA
TGTAAATATTATTAACTGTAAACCCTATCAATTTGATCTGGGGCCCATATTTAGCACAAG
AGCCTGTTGTTAAAATTTCATGGCTCCAGCTGGCCGGGTTAGCTTCACGGACGGGTAACA
GAGACGACCAGAGACGTACGGCTGGGCAGGGAAGCTATATTTCTTTATTCAGGAACAATG
ATTCATAAAGTAAACCAAACTAATCACCAAACAGAACTCTGCTGCCTCTTTCCCGCGGCG
GCACAAGCACTCTCTTTTACTCTGCAACTCTCCAACTCTCTAACTCCTGAACTCTCGAAC
TCTGGAACTCTTCAACTCTCCAACTGTGGAACTCTCTAACTCAGGCAGGGTTCCTAGGGG
CAGGGCCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved