Erinaceus_europaeus Locus Mono:287:SNORA33
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:287:SNORA33
Erinaceus_europaeus
Mono:287:SNORA33
scaffold_207663
SNORA33
1001..1122
2122
CTCCTGGCTTTGAGATGCTGGGAAGAGAGAATGGAAGAGTACAGAGCAGAGTCCTTTCT
GGGTTGAGACACAATCTTTCACATGGTGCAAAGATCGCACATGAAACCTATATGTTGTCA
GAAATAAATGTTTCTCCAGTGATTACAAGAACTGCCATTATTTGAAAGTATCCTGTCTCT
CCTTTTCACCTCAAGTAGCAAACTTTCAGTTATAGGGCCTCTGTAGTCTGGGAAGTATTC
AATCCAGATGGCAGGTTTTGGTCTCTGGGGAGGACACACTGTCTTCTCACAGAGAACTGT
GTTTCTCTGGCCTTCACCTGAGGAAGGAAAGCTTGTTAGTTCTCTGTGGGCTACTCTTGG
GCTTGGATGTTACTTGATATTGTGTTCCTTTCTATCATGAAGATACTCATAAATATATAT
TTCTGCTAGATGAGCCTGCTCAGATAGCCTTATTACACTATTCTATGATTACCTTTAAAA
AAAGGCACTTAGAAGCAGTAGGTGTAACTTAGAAAGGAAGAGAAGAGAGGGCCTTAAGAA
ACAATGGGCAAAGGAGTCGGGCGGTAGCGCAGTGGGTTAAGCGCATGTGGTGTGAAGCAC
AAGGACCAGCTTAAGGATCCCGGTTCAAGCTCCCACCTGCAGGGGAATCACTTCACAGGC
GGTGAAGCAGGTCTGCAGGTATCTATATTTCTCTCCCCCGCTCTGTCTTCCCCTCCTCTC
TCCATTTCTCTCTGTCCTAACAACGACAACATCAATAACACTAATAACCACAACAATAAA
AACACAAGGGAAACAAAAGGGAAAATAAATATAAAAAATTAAAAAGCAAGCAAACAAAAA
AGAAACAATCTGCATATAAATAAAAATATAAATATATAGTTATAGAAGTAATAGTCAACC
TATATCCGTAACATCTGGAGAAGAAATGGTTCCAATGGAGGGAATGGGGACACAGAACTC
TGGTGGTAGGAACGGTGTGGAATTATACCCTGTTATCTTGTAATTTTTGTAAATAAGTAT
TAAATCACTAATGGAAAAATTCAAAAGAAAAAAGAATTAGCAATGCCATGTTATGAGCCT
TATGACATTGGGGTCATTAAGGTCCCTAAAAGTGGCTATATGAAATTTTAATGAAAGGAA
GTGTTTTAAGTAATATGGTAATTATGACATAAGTTTTAACTTTATATAGAATTTATAAAT
GTTAGTAATTGAACTTTTTTTTTTTTGGACTATGGCCAAAGATGTCATTGAGGAATACTT
CAAATGAAAGAAATAAAAAAATTGGCTCTTAAAAAAAAGAAAAAAAAATGTAATCTACAA
TTTCCTGGACTGATGAAATAACTTACCTGAATAGCACATTGTTTTGCCCTGTGTGTCACC
CAGTATTGAACCCAGACCCCATCATTCTTGAGGAAGCTCAGTGCTGTGGGATCTCTCCCT
CTCTCCTTTTATAAATCTATAGATATACCATTGATTTCAAGAGAATCTTAGAAAGGAGTA
ATAAGCATGCTATCTGAACAGAATCAATATCCTAGAGAATGATTATTTATGAGTATCTAC
TTCCCACACTCCAGAGGCCTTAGAACTCAAAGTTTGCTATTTGAGCTAAAAAGGAGAGGC
AGGCCATTTTCAAATAATGGTAGTTGTTCTTGTAATTGGGACACTGGAGGAACATTTCCT
TCTGGCAATATCTATGCTTTAGGTGTGGTTTTTGTACCACATGCAAAACTGTGTCCCCAA
CCCAGAAAATCAGCCTAGGAGAGGAGGACTTTGCTTTCTGCTCTCCTGTCTCTCTGCCCA
GCCTCTCAAAGTAAGGTGTGCCATGTTCTGAAGTTTTAACTGGTACACTGTGTTGATTTT
TCATTTTTTCATTTCTATTATAGAAATTATATATTTTAGGAGGCTAAGTGGTGGCACACC
TGGTTGAGAGCACATGTTACAATGCACAAGGACCCACATTCAAATCCCTAGTCCCCACTT
GCAGGGGAAATGCTTTGTAAGTGGTAAAGCAGTGCTTCAGGTACCTCTCTGTTTCTCTTC
CTCTCTAGCTCCCCATCCCCACTTGATTTCTAACTGTCTCTATCCAATAAAGAATAGAGA
TAAAGGGAGTCGGGCGGTAGTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved