Erinaceus_europaeus Locus Mono:200:SNORA17
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:200:SNORA17
Erinaceus_europaeus
Mono:200:SNORA17
scaffold_67691
SNORA17
1001..1129
1873
CATCCTCCGAGCCTCATCCTTGATGCTGGGGATATCAGGTGGTGGTGGCTGCACCAGTG
TGGTCACCTCTGTGCCCTGGAAGCCAAAGGTCAGGGGCCAGCCCAGGTCGAGCTCAGGCA
CAGCCTGGTCTGAGTTCACAGGCCAGTATGTGCCTGAAGAGCCATCAAAGTCCACGTTAG
GAGGGCTGCCTTCTGAGGGCTCTCGGATGACATGCTGTGGGGGCTTCAGGTGGCGGCTCA
CATACTCCAACTCCTCAGGGCACAGAAAGGCAGGTGCCCCCTCAGTTGCCAGGAATCGGC
TGTAGGCCTCAGGCCCACCCTCTGCCAACGCATCCACTGCCAGGCGATAGTATTCTTTGT
AGTGAGGTGGCAGGTACCCAGGTGCCAGTGGGTTGTCCCCCTGTGAGGAGCTCTGGGAGC
GACGGGCCATGTTGGGGCCAGGGACCTGGGGGGGGGCAACACATTACCAGGGCAATGGCA
TTGCAATGGCTTAATCCTCCTGTGTCCGTGAGCTGTGGCACTCAGCCTGTGCCTGGGAGC
CTTCTAGGGCACCCCCAGATTCTGGGGTGTTGGAAACCTCTAACCCTGTGTTTGCTATTC
TGACCTGGGTTGGCAAACCCTGCTTGATATCCTCTTGTGCCTATGTAACACTTTTTTTTC
TTTGCTGCCAGGGCTTCATGTCTGCATAATTTCACCACTAGATGACTTCCCACTCCCTCC
CCTCTGAACCCCAGATAGAGGGTGAGGAAGAGAGAAGCAGAGATACCACAGGACTTGCTC
CACTTGTGAAGTTTCTTTGTGTGGAGCTCCCATGTGGTGGCCAGGGATTCTAACTCAGGC
CCTCACACATGGTAAAAAACTGTTTTACCAATCAGGCCATCTACCATTCAATAGCCCTTC
CTCCATAAAAAAAAAAAAAAAAAAAAAAAAGTAGTAAAGTCATTATTTTATTACTGGTGG
TATACAGAAAATGTAATCCAAACTGGATTAAGAAAGTTTTTCCTGCCCCTAGAGGCATTA
CGGATGTGAATGCTTTGTCACATGTGTGTCATTAGGTGGCAGAGAGAAGAGTCTTGTCTA
CGTCCAGTGCTCTGACCTGTGAGCCACTGTGTGATTGATAGTCTGACACTCAACACAGTG
CCCCCGCCTGTTACTGCGTGTTTATTGGCAACCTGAATCCTGTCGTGTAAAAAAAGCTCT
CATTCTTCCTTAGTACCTGCCTGCCCTCAAATCTCCAGGCGACCCTGTGATCTGAAGACT
GGTGTTCATCTCTGTTGGATGAAGACTGATGGCTCACCATTCAAGGGGAAGGTGACTGTT
AGCCTGTTGACAATGACCTTATGGAATGTCTGACCTCTGTCCAAGCCCAGGTTACCAACC
AGCCCAACATCCAGAGGTGGTGTTAGATCATCTGAGAGATCTGGTCACCAAATGGTGCAG
TGACCTTACCAGACAGACCAATACACCATCCTCAACCTTGTAGCAGATGCCAAGAGACCA
GGAAAATGCTAGAAGGCTACTCTGCATCCTCCAGAGGCATTCACACAAATCATGAGGATC
CACAGCTGGTCAAGCTCAGGGCCTCACAGCACTAAGTACTCCCTCACTGTTCTCCTAGTT
TATGGATTTGGGAGGGAGGAGAGAGTATTTGGTTCCCAAAAGTAAAATTAAAGGGACTTT
GTAAAACTTGAAGAAAAGCATTGCTGGGGACACTGGGTCATTTGTGGTACCTTAGCAGCT
GCCAAAATCAGCCTGATAAACACTGGACCTCAGTGCAGAGCACATCACTGTCCCAGGACA
CAGAACAAAGTCCCACCTACCCGAGACCCACTGGTCTTGCACCTTCTGAACTGTGCCTCA
ATTCACAAGACCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved