Erinaceus_europaeus Locus Mono:332:SNORD45
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:332:SNORD45
Erinaceus_europaeus
Mono:332:SNORD45
scaffold_3391
SNORD45
1001..1080
1185
AAAAGAACCAGACACCAGCCTGGTACGTGTGTTGCTGGGGATTGAACTCAGGACCTCAT
GCTTGAGAGTCCAATGCTTTATCCACTGTGCCACCTCCTGGACTACCTCTCTTTTAAATT
TTTACTATTTATTTATTTATTTTGCCTCCAGGGTTATTGCTGGAGCTCGGTGCCAGCACT
TCGAATCCACTGCTCCTGGAGGCTATTTTTCTCATTTTGTTGTCCTTGTTTTTGCCCTTG
TTGTGGTTGTTGTTGTTATAGCCGCTGTTGTTGGCTAGGACAGAGAGAAATGGAGAGAGG
AGGGGAAGACAGAGAGGGGGAGAGAAAGACAGACACCTGCAGACCTGCTTCACTGCCTGT
GAAGCGACTCCCCTGCAGGTGGGGAGCCGGGGTTCGAACCGGGATCCTTATGCCGGTCCT
TGTGCTTCGTGCCACCTGCCCTTAACCCGCTGCACTACCGCCTGACTCCCCACTATTTTT
ATTTTTTAAATTGTCTTTATTGATTTATTGCCTAGAGACAGAAATTGAAAGGAAGGGGAA
ATAGGGAAACAGAACACAGACACCTGCAGACCTGCTATGCCACTTGTGAAGCTTTTCCCC
TGCATGACCGGGGGCTTCCGGGGGCTTGAACCCGGGTCCTTGAGCACTGTAACATGTGCG
CTCAACCAGGTGCACCACCACCGCCCCCTAGGAGAATCTCGTTGTATAACCATTATGCTA
TCTCCCGCTACCGCCCCACCTTCTCTTTTCAATAACTCTGTGTGGTTAGTACTACCAGCC
TTACTTTAGAAGTGAGGAAACCGAGGTTCCAAGAAGTAACTTTACGTCCAAGGTCACACT
GTGCACTGATGGCAGAGCCGGGACCCCACGGTGACCCCTGGGACAGACCTGGCCCCAGAA
CTGTGGGTCCCTCACCATCCCACTCAGCTGTGAGCACAGGGGTCAGTCGTGAGCCTAGGG
CACTGGCGGCCAGGCCTTGCGCAGGGCTTCTACCTGCCTCCGGTCAAGGATGCTCTGCAT
GTATTATCTGACATGAAAGCTGATGTGGAGAACACTGGCTCTGGGATTACACTGAGACCT
TCAAAAATATATATATATATATCACCTGCCTCTTCTGCACCGATGCTGTTCTGTTGAATT
CCTTGGAAAACTCCACTACCTGCCTTTTTTTTTTTTTTTAATATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved