Erinaceus_europaeus Locus Mono:79:SNORA62
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:79:SNORA62
Erinaceus_europaeus
Mono:79:SNORA62
scaffold_7755
SNORA62
1001..1143
2143
TATGTCTTGCTGGATCCAAGATGAAGCCACAGGCTTCACCACTAGCCAGGAAGTTATCT
TTGTTGTGAATAATAAGACAGAGATCATATAGTTGAGTCCTTTGGGAAGTTTATTATGAG
CAGCTTATCCTGCCACAATTTCTCAGGTTTTGGGGGAAAGGTTTGGGGAGCCCCTAGCAG
GATGATTCTTGCCCATGAGAAGACCCTGGGATCCCTAACTTCCTCAGAGGGGAAACCTTT
TGATTTTTTTTTCATATGCAATTCATCTATATATTACTGACCTGTCAAGATATCTTCTAG
TTGAATAAAAGAGATGAAGTGGAAAGGCTTCATTTTAGCTAAAGAAATCATATGCCAGGC
CTACCCTTGAGTTGGTGGGGATCCAGGACTGACATATATCTATCTTTAGTCCCTGGTTCT
CCAAGAAAATGAGGGAGGATGGACTAAGATCAGTTTTACGGACTTCCTAATGAATTTTAT
AACTCCAACTCCTAAATTTTTATAGAGTGTCATCATCCATGACTTTAGCCCTGTTCTGGC
AAATTCAACTTAATACTTTTTACAGTATAATTCAGAGTATGAGTTTGATCTTCATCATCA
GCTATTAAAAATAGTTAATGCACACTATTAAAGCTCAGGGTGAGGGGTTAGGCAGTGGTG
TACCTGTTAGAGCTCACATTTACCATATACATTGACCCAGGTTCAAGCCCCTAGTTCCCA
CGTGCAGGGGAAAGAAGCCTCATGAGTGATGAAAGCAGTGCTGCAGGTGTGCCTCTTTCT
CTTTCCTCTATCACCCCCCTTCCCTCTGACTTTCTCTCTGTCTCTACCCAAAAAGAAAAT
GAAAAAGGGGGAAAAAAAAGGTCACTGGGAGCAGTGGAAGGCAGCTATGCTCACCACTAT
ACCACCAACGCAACTGGGAGCAGTGGATTCATTGTGCTGGCACTTTTTCTTCTAGCACTG
AACTTCAGCAACAATCCAGGTGGTATTAAAAACAAAAAACAAACACATAAAAAAAGTCAG
GGTAGAGGGCAGTTTTGACTAATGAATGGAGTATTGGCAGTATGCTATACTAACTGCAGG
ATTTCGCCAACACCAATAGAGTTTGCCTCTATGATTAGAATCTGGTGTACTCACTGCTAT
ATTCAACTAAATAGGAGAATGTTCATTTTTTTTTTTTTTGCATCCAGGGTTATTGCTGTG
GTTTGGTGCCTGCACTACAAATCCACTGCTCCTGGAGGCCATTTTTCTCATTTTTGTTGC
CCTTGTTACCGTTGACAGAGAGAAATTGAGAGAGGAGGAGAAGACAGGGAGGAAGGAGAG
GAAGATAGACACCTGCAGACCTGCTTCACAGCTTGTGGAACGACCCTCCAGCTCCAGGGA
GCCAGAGGCTGGAACTATAGAACCCAGAGCTTTACACAGGTCCTTGCACTTAACACCATA
TGCACTTAACCTGCTGTGCTACCACCTGGCCCCCGAGAATGTTCATTTTTAAAGCTGGGT
CAAGTGTGTAACATAGTTCCTGCCTTCACCTAGGGGGAGAAAGTTTAAAAACACAGTTAT
GGCATGATGAAATCAAAACAGCTTTTAACTGCTAGCCAGCAATCACATATCATCCCAACC
CCTTTACAAATAATTTATTTATTTATTTATTTATTTATTTATTTAAGAAAGGAGACATTA
ACAAAACCGTAGGGTAGGAGGGGTACAATTCCACACAATTCCCACCACCTGATCTCCGTA
TCCCATCCCCTCCCCTGATAGCTTTCCCATTCTCCATCCCTCTGGGAGTATGGACCCAGG
GTTGTTGTGGGATGCAGAAGGTGGAAGGTCTGGCTTCTGTAATTGCTTCCCTGCTGAACA
TGGGCGTTGACTGGTCGATCCATACTCCCAGTCTGCCTCTCTCTTTCCCTAGTTGTGTGG
GTCTATGGGGAAGCAGAGTTCCAGGACACATTGGTGGGGTCATCAGTCCAGGGAAGTCTG
GTCAGAGTCATGCTGGCATCTGGAACCAGGTGGCTGAAAAGAGAGTTAACATAGAAAGCC
AAACAAATTATTGAACAATCATGGACCTAAAGGCTGGAATAGTGCAGATGAAGTGTTGGG
GGGGGGGTACTCTCTGCAGACTATTGTGTATTTCAGCTTTCAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved