Erinaceus_europaeus Locus Mono:450:SNORD87
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:450:SNORD87
Erinaceus_europaeus
Mono:450:SNORD87
GeneScaffold_7488
SNORD87
1001..1090
1413
TAAGTATTTCTGTTGTGTGCGGCGGTCCATCCCCTTTACAGTACCGAGCTCTCAGGCAG
CTTGGAATATTTCTACAAAACTGTCAGTATGTCTGGCAAATGAGTTAACACATACTGAAG
TCACATTTTTAATTTTAATTTACAGATGCATGAGAACATAAATTCAACAATTATGGAGGT
CATCCTGTTTCCCAGAAGACTGGTGACCGACTGACTAAACCCACTAGAAGCATTACACAT
GTCAATAAGGTATCTAGCTTTATTGTGTCCCTTTTTGGGAGTCATTGCATTCCTAAACAA
ATATTTTTGGCAAAGAGTTGAATAACTGGCACAATGATGACTTAAATTACCTTTTGCCGT
TTACCCATCTGAGAGTTTCTTTGAAGAAATTACTTCTAAGACTGAGATGCCAGTAACCTA
TGTTTATGTTGACTTCTCAGATACATATATTTTTTATTAAACTGGATGAAAATGTTTCTG
TATACAGGTAGCCAACAATTTTCAAGTCTTGCTGTAATGTGGACTTACTCTTTGTATCAA
GTAAGTGACATCTTTCCATCAAATTAAGCACAAAATTTTTCATTGTCACTGTTACTTTTG
AGTTTGTCAGTGGGAATTGTTTTTCATTCTTGGCTTCTGTTTCCCAGGGGTAATAACATG
GAACATTTGGTAAAGGAGATTTGATCAAGAAGAGGACGGAAATGACTGAAATGTTATTTT
GTTATTATCATAGAATAAACTATGTAAAGGACATAGAATATTTTGAATTGCTGGATAATA
AATTGTTTTCATATAGACTGTCGCTTGAAGGTGATTAGCAGTTGGGTATCTGTAGCTCCC
ATGCCCATGGAGACTTCTGGGGAGGACCTTAACTTTCCTAGTTTTCTCAAGACTTCATTT
TGAATTGTTCACAGTGAGGCTGACATTTTGAATTGTTCACAGTGAGGCTGAGGGCGCGCA
CACAAAGCTAACAGACACCCTGGAATCTAGCCCAGCAGCAAGGCAAGCAGTATGTATCTG
CAGAAAATTTTTAACTGGGAGGCTATTTGGTATGCATGTGTGAGGACCTTGGTTCAGCCC
CCAAGTACCACATGGAAACTACCTGGCCTTGAGACAATTGTAAAATATTTTTACGGGCAG
TGGGTTAAGCATACTTGTAAGGATCCCGGTTCGAGCCCACCTGCAGGGGAGTCGCTTCAC
AGGCGGTGAAGCAGGTCTGTAGGTGTCTGTCTTTCTCTCCTCCTCTCTGTCTTGCCCTCC
CCTCTCCATTTCTCTCTGTCCTATTTAACAATAATAACTACAACAAAAAGGGAAAGTAAA
TATTTTTTTTTTAAATTTATTTTAGGTGGAAATAACTTGAGAGGGAAGTAGAGATTGGGA
GAGAGAATTACAACAATGCTTTACCATTTGTGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved