Erinaceus_europaeus Locus Mono:22:SNORD46
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:22:SNORD46
Erinaceus_europaeus
Mono:22:SNORD46
scaffold_344468
SNORD46
1001..1104
2104
AAAACAGAAATGATCACCATCACTTATTATTAGGGAAATCCATTGGATCGACTTTCTCA
TGGTGCATCCCGTGAGTACCCATTCATTGGGGAAACTGACGATCCTTCCTAGCCGACTGA
ATCCACATGGATCCCAGTCACTTTAAAGCCAGCAACAAGCAGCACTTGACAGCTTTGCTG
TTGACTGGCTATGGAAGAAGGGCAAACGCTAGAAGAAGAAGGGAAATCCACATCAAAATA
AGAGGTTATACCAGTTCTTCTTCTAGCGTTTGCCCTTCTTCCGTAGCCAGTCAACAGCAT
CAGGTTGAGCCTGATGTAAAGTTTCGAGACCTCCTTTGAATCTGGAGAGGTGGTAGTTGT
TGACTATGTGGGTCATAGTCTGTCTGGAGCCGCAGAGGCAGTTAGGGTCGTCTCTGGCTC
CCCAGCGATGGAACATAGCGGCGCACCGGCCATGGCGGCCTGTTCGATAGCGATTGAGGA
GGGCCCAATCATAACGTGCTAGGTCAAAGCCGGGTTGACGCTTGCAGGGGTCTGTGATGA
GGTGTTTGTTCTTTACCTCAGCTGACTGCCAACTCTGTTTCCAAGAGACTGGAACAGAGA
AGTTCAGTGTAGGTGTAGGGGACCAGATTGGGTGACGAGACGTCAAGCGTTGGACAGGGT
GGGTGAAGATATCTGCGTATATTGGCAGGTCCAGTCGAGCGTAGACATGGGAAATGAACT
TAGATGATGCCGGATCCCGACGAATATCTGACGGGGCGATGTTGCTAAGGACTGGCAGCC
ATGGAACCGGGGTGGAATGGATGGTTCCAGAAATTATCCTCATGGAGGAATATAATTTGG
AATCGACCAAGTGGACATGGGGGCTACAGAACCAGTAAGAATGGCCTACATTAAAAAGGC
CAGAAACAGGTTCTGGAAAGAGGGTGAAGATAAGGAATCCCTTATACCCTGCTGATAGGG
AATGAAGATTGAATCTGCTCTTATATAAAAAAAAAAAAAAAAACTAAAGTGATGAAAAAG
TACCCTTAGGCATGGTTGTGACCATCTTGTTCGCATTTCTGCCACTCGCCAATGCTGGGG
TTTGTCATAGTTACACTGACTGGTACCTCCACTTAGCTGTTGCTTCTGTTTCTTCCCTGT
CTGAGCCCCCGACCCCCTAAACATTTCTTCCGGCTCTTTCTGTTTTCTAGATTGGCCGTC
GCAGCATACACATGGTCTGTGGGAGGCAAGAAGAAGTACCGATTCTTGAGGCTGGACATG
GGGAACTTCTCCTGAGGCTAGGAGTGTTGCACATGAAAAACAAGGATCAACCAAATTACC
AAATAATGTGATGTTAACAATAACTATCCACTGTCTTCTTGAACCCTAAGACAGCAGGAA
CCTCACATTTCCACTATAGAGCCTAAACTTCCCCCAGTCCTGGGACCCTAGGATATGGCC
TACTTCCCCTTATGCTTCTCCAAATTCTTATCAAATGACATTGCATCTGCCAATTGCAGC
CTAATCAACACAACGAGTGCCACCTCAACATGCTTCAGCTCAGACTGCTTCTAGAGACTT
TAGGTGTGGAATAACAACCCTTCAGCTTCATTACACAGGTGAGACCTTTCCTTTCATAGT
ATTCTCTAATTCCATTCCAGGTGGACTTCCTAACAAAGTCCCAAAACCTAGATATACACC
AGTTTCTGTGAGAGAGAGCATATGTTCACACGTATCCGTAAACTACTGCAAAATATATAC
CTGAAAGCAGAAGTACACTAGAGTTTGCAGTGAGTACCCCCCAACACTTCCTCTCCACTA
TTCCAACCTTTGGGTCCATGATTCTTCAACAATTTGTTTGGCTTTGTATGTTAACTCTCT
TTTAAGCCACCAGGTTCCAGATGCCATCAGGATGCCGGCCAGCTTCTCTGAACTGAAGAA
CCCACCAATGCATCCTGGAGCTCAGCTTCCCCAGAGACCCACCCTACTAGGGAAAGAGAG
AGGCAGACTGGGAGTATGGACCGACCCAGTCAATGTCCATGTTCAGCGGGGAAGCAATTA
CAGAAGCCAGACCTCCCACCTTCTGCAACCCTCAATGACCCTGGGTCCATGCTCCCAGAG
GGATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved