Erinaceus_europaeus Locus Mono:70:SNORD49
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:70:SNORD49
Erinaceus_europaeus
Mono:70:SNORD49
scaffold_344473
SNORD49
1001..1069
2069
CCCTCCTTGTTGGTATTTCTGTGACTAAACATGCAGAAATCACTTACCTGCCATGAGAT
TCTGAAAGGCAGAAATTTCACAGGAGATACTTGGTTAGATTTGGAGCATCAGTGTTGTCT
ACTCCATATTATGAATACAAAATGAAATACATAATATAAGGAATTTTCCATAGGTTACCA
ATATAGAGGCAATTATAACTGTTTCAAGAATAATATAAGATGGTTAATCTTTATATAGTA
AAATACCTGAATTGTTTCACACAGCATCAGCTTAACCTCTTTAATATAAGAAATGAAAAT
AGAAAAATCATAAAATATGGAAAAAAGTAAGCATGTTTTGGGTAGATGAGTAACTGAATT
TTAATTACTTTAATTTTAATGCTGTTCGGGAAAAACTGATCGCAAGGCCAAATTATAAAA
GTAGTTATCCCCTGACTGAATGTGAATTTTTCTCAAAACTCCTAACAGGGACATATTTTA
AAAGGTGGGAAAGGTTAATAAATTGCATCATGAGGAGATCATCCTTTAAGCTAGATGGGC
CCACTGAAGGCTCACAGCATCTCTTAAATGTATGAGTTTCCTTGAATTCAAGAGTATATC
CCAATTAGAGCAGCTGTCAACTTTGCATGCCTTAAAACCACACTATAATCTGTAAGTATG
TGAGTAAAATCCTTATATCTGAGGAGAAAAGCTCATTATCTCACTATAACAGCATCAAAG
ATGCCAACAGAGACTTTTCAATGATCAGAGTTCCCTCTGAATAGAGGAAGCAAGAAGAGC
AGTGCACCAATGGTGTGCTCTGCCCTGGGTATTACCGGCAGCTGGAAAGGTTATGTCCAG
AAGAAGTGAGTTTTTCCCATCATATCATGTATGATGGTGTTGTGATGTTACACATCAAAC
ATTAATATTGTATTCAATTGTCTTTAAAGTCCCCCACCATTTTTATCAATGATGAGATTA
TTATTTATTTTGCTAACCTTCAGTCAATTAAGTAAACCAAAAGATTGAAAGAATACTTAT
AGGAAGTGCTTTCAGATGGGATAACTGATGATAATAACTCCTATTAAAAAAACTATCAGG
GGAGGGGGTGTGATACGGAGTAAGAATACTTCAATATACACCCATCACATAAGCATTTGT
AGTGAGAATTAGTATTGAAAGTTTTTGACAATTGAATTTCTCTCTTAAGACACATTGAGC
TGCAAATTTCTTCCTGTTCTAATCTATCACTAATTCACTTGTGACTTTAGTTGAGATAAA
AAAAAATAGCAGTTGGATTATAGCTGGCAATATTTAGAAAATAAAAAAATAATTCCCAAG
TAGTTTGCAACTTCCCAGGCATAAAGAACTATGCGAGGCCACAAAACTAAATAGCTATCT
ACGAACTGGTGTTATATCAGTTTATATTCCTAGGGAGATAAAATGANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGATGA
CTTCTAGATAAGTCAGAGTGTGAAAATAAAATCAGTATGTGAACAACTAAAGCTTTTCTT
AAAGCATAACTTGAAAACAAGGCAAGAACCATAAAGAATCTTTTCTAAGATGGAAAAAAT
AATCTTTTCTAAGATGGAAAAAAATAAGTATATTGGATACTAAAAGCAAGATACTGTCAG
AAAAACAGAATCAGAGTATTGGATGAAGAACAACTCCTGGGTAGATGAGAGAAGACAGAA
TACAAAGTGAACATTGATTTTATAACATAGAGAAAGTAGGTGTTCTCATCTCTGGTACAG
TGGACATCATATATGAAAACATAAATGAAGCATAATGAGAAGGTCTTCATCTGCATATAA
GAAGGAAGAGAGGTGTTGAGGGTTTCAATAGAGAACAGAAGGTTGGGAATGATTTCCTGA
GAAAAATCAGAGAAGTAATTGATTTAGGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved