Erinaceus_europaeus Locus Mono:456:SNORA26
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:456:SNORA26
Erinaceus_europaeus
Mono:456:SNORA26
GeneScaffold_2985
SNORA26
1001..1121
2121
CTTTGTTTCAGATTTTCCAAGATAGTGTGAAATGGCTCAGAACCAACTTGCCACAATTC
AGTGAGCTACAAATAATGGTTTGATTTGCTTAGTGTATTTTTCCCCCAAAATATCGAACC
TGTATATATTGTTTCATTAACTTTAACAGTTTATTTCTTTTATTTTTATTATCTTTTCAG
ATATATAAAATTCTGGTGTTTGAATAGAAATGCAAAATATCACTGTGATGTCCAGATCAG
TTAGTATTCATTACATTTGTTGAATTTTCAGGTAGTGATTTAAGGCCATCATGTAAATGA
CCACAAGTCTAGAGATTCACATCTGAATGAGATTCATTCAGTTCTACTAAAACCCAATAA
AATAAGTGTGAAAAGTCACATAAATGAAAACAATGACCCATGGCATGGCTACAGTATTCT
TTGGGCCATTAAAGTACAATGACTTCATCATCCAAAAGTGCCGGGTAAGGTCGAGATGTT
TAAGGGCTGACAGACTTAAGGACAAAAAGAGGACATTAACAATTGTTAAGTAATTTTTCT
AGTTAGACAACAACACATGCTATTTAATTGTCAGGATAATTCTGTAAGTGAGGTTTTCTC
ATCCCCATGTGCAGAAACTAAAACTGAAACACAGAAAGTATCATTCTGTAGCGGTTACCC
ACCTAGTCATCCAAAAACAATGAAAATATATAACTGTTTACCTAATGCTAAAGTCTATGT
TCACTATACTCTGGGAGTTGTGAGATTTTCCTCCGTAGCCAGGTCTTTACCACTTCAGGC
TGGTTTTTTTAAAAGGGAAGACAGACCGAGATGGAGGGAAAGAAGGAAAACACCACAGCA
CTGATCCTCTGATAACTTCCTTCTGAGCAGTTAGAGCCAGGCTCAAATCTGAGTGGCCCT
CATGGCAAAGCAGGCATCCTTCCAAGTAAGTTATCTTGCCGACTTTAAGGTGCTCAGTTC
TAAGAAAAGCCTCTTAAGAGTGACAATGAATGCTTTTTCCTTTGCCCTTTTAAAGTTAAT
GCAATGGTTTGAGAGGCTAACACAGAAGGGCAAAATAAGTGTCTATAAAACCCAGGGAAG
AGGTTATAAAAATTTTCTTGGATCCTATCTGGACCCAAGAAAGTAAGTCTATAATCTCCT
ATCTCTTCTCTTGAATATTAATCCTGAGTTTGAACACCTTTTTTTTTTCAGTTGTAAATT
TTTTTTCCTTTATTGGGGGATTGATGTTTTACAATAGACAGTGAATAACAATAGTCTGTA
CACGCATAACATTTCTCAGTTTTCCACATAACAGTGCAACCCCCACTAGGTCCTCTGTCA
TCCTTATCCAGGACCTGTATTCTCCTCGCCATCCACCCCAGAGTCTTTTACTTTGGTGCA
ATACACCAACTCCAGTTCAGGTCTGAACACTTTCTTGATGCCAGTGACATCGGCAAGAAA
GTGGACACAGGGGACAGTGAGCCATTTATTAGCTCAATGGCCTGGATAAGCCAAAGGTAC
AGCTAGCTTTAGGCACAGCCAAGTCCATATGCATATTCCATGACTTTCCAAACACAGGAG
AAAGCAGCACATCTTTTTTCTAGTGGTGACCAACAAGTTTAGAGTTTGATCTTCATTAGC
CCACCTCATGGTACCATCCACCACTGCACCAATCACTATGAGAGGGTGCCATGACATTTC
ATTGAACAAGCCCTGGTCTTAGCTAAGCCCACTGCTGGAAGATGAAGTCAGTCTTCCCCA
CGGTATGAACTAAATGGAAGAGACTGGTTCACAACAGGAAAAGGGGGTATAGTTACTAGA
CAAAGGTATTGATGCTGGGCAGACAACAGTTGCCAGTGTAAATTGAGTGATAACACTCTC
AAAAACGTATTTCCAACATGGACAAAGCAGTTCCTTTCAGTGAGGTCGATGAGGTGAGGT
GTTCCCTCTGTTCAAGAGGCAGACTTAGTCTAGCAATTAGCTGTCAACTGATCACCAATT
CTAATGTGCAGGAGTGGGTCGTGCTGATGATCTGTGCTCGCAATAATCATCTGGCTGGGT
AAATCAAATTATGCTTTCCAATGCCACTTCACATCAGAATTGCTATGTCTGCCCTCGTTT
TCTGCAGTAAGCATTACCCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved