Erinaceus_europaeus Locus Mono:134:SNORA23
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:134:SNORA23
Erinaceus_europaeus
Mono:134:SNORA23
scaffold_13637
SNORA23
1001..1175
2175
CTTCAATGCATTTATAAGAATTCAAACAAACCCAGTATGTGTGAAATCTGGAGGAGAAA
AGCTCATATAGGTATTTCTCACACTTTTGATTAATAGTAAGTTGTACCTTTTGTAGCAAA
GAAAATAACATTTTGAGAGGTTTCTGAATTCTGTCATTTGGATAAGAGATAATTTGTGTT
CCAGTCCTATGGAAGATAAGAATTTATCATGAATGAGCTGAACCTGGTAGTGGTCTACCT
CCTGTAGATGTTTTCTTCATTCTATAACCAACAACACTGACAAACAATGGCATGTTTTAA
AAACTTTAATAAGTAAATTTTATCACTATACTAAAGCATTTCAGTGCTCTTTCTTCCCAT
GATTTTTGTATGTTAACTCTCTTTTCAGCCACCAGGTTCCAGATGCTAGCAGGATGCGAA
CAGACTTCCCTGGACAGACAACCCCACCAATGTGTCCTGGATCTCTACTTCCCTAGAGTC
CTTCCCCACTAGGGAAAGAGAGAGACAGGCTGGGAGTATGGATTGACCTGCCAATGCCCA
TGTTCAGTGGGGAAGCAATTACAGAAGCCAGACCTTCCACCTTCTGCATCTCACAATGAC
CTTGGGTCCATACTCCCAGAGGGTTAAAGAATAGGAAAACTATCAGGGGAGGGGATGGGA
TATGGAGTTCTGGTGATGGGAATTGTGTGGAGTTGTACCCCTCTTATCCTGTGGTCTTGT
CAATATTTCCACTTTATACATAACATTTTTTTTAAATGCCAATAATTTTCCACTAAAATA
TACTGAGTCCCTTTCAGCCTCCTTTCCTTCCTATGATCTCTTTGGTGACCTCAGTTCCGT
AGTCAAAATATAAGGTCTTGTTTCCTTTTGACATGGTCTATTTCCTTGCTTTGTTTCTCT
ATATTTCACATTTAAATGAGATCATCTGATACTTATCTTTCTCCTTCTTAGTTATTTCAC
TTAGCATAATACCTTCCTATCCACACTGGCACAGAGGATAAGCATTCATTTTTGCTGTTT
TTTATCTGTGTCTGACTGCAGTGTCCATCTGTATTTTGCATTCAGATCTAACCTCACAAT
AAGCAGCTAGGGAGTAAACTGGTATCATAGTGCTGGTTTAGTGTTGTCTTTTCAGACATA
TCTACCTCTGGCCAGACTTCAAATCCTCAATCTCCTCCCCCCCTTTCTCTTTCTTCACTG
GGATTTGGTTACTATTTTTTCACGGACTGAAGAAATTGTTTGGCTAACTGGTAACGATTA
AACTCCTTCAATACTTACTTCAGTTGCTACTGTAATTCCGGAGGTTGGTGAGTGCAATTG
TCATAAAGGTATTTAGTACAGTGTTACTTGTACTCAAGACACAACAACTGAGGAACAACA
GAGCATAAAAAAAAGAGAAACACATAAATTAAAAAATGGGTAGATTAAAAACAAATAAAA
CTGCTACCCCAATGAATGAAGACAAGAGCCCAGAAGAAACCACAAATCAGTCAGAAGTAA
CCATAGATAAAAAAGTATGCAAGCAATAATAAACTTATTAATCACAGAAATGAAAACAAC
ATTGGAGGAAAGGAATGGCAGTATTAGGGAAACAACAGTTGAGACCCCCAAGAAAAATAC
TGATTATCTTGAGACAATTAGAGAACTGAAAGCTGAAATAGCTGTAATGAAGAAAGAAGC
TGAGGCAAGGGAAAGCAGACTAACAGAAGCAGAAAACAGAATTAGTCAGACAGAGGATGA
GTTAGAGAAAACTAAGAAAGAGGTGAAAGAGCTTAAAAAGAGATTGAGAGACACTGAAAA
CAACAACAGAGACATATGGGATGATCTCAAAAGAAGTAATATTCGTATAATTGGCCTGCC
AGAGGAAGAAAGAGAGGAAGGGGAAGCAAACATTCTAGAGGAAATAATACAAGAAAACTT
CCCAGACCTGAATAACAGAAAGGATATCAAGGTTCAAGAGGCCCAGAGAGTACCAAACAG
AATCAACCCAGACCTGAAAACACCAAGACACATCATAGTCACAATGAGAAGAAGTAAGGA
TAAAGAAAGGATCCTAAAGGCTGCAAGAGAGAAACAAAAAGTCACATACAGGGGAAAACC
CATAAGACTTTCTGCAGATTTCTCAACTCAAACTCTAAAAGCCAGAAGGGAGTGGCAAGA
TATCTATCGAGCCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved