Erinaceus_europaeus Locus Mono:453:SNORD18
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:453:SNORD18
Erinaceus_europaeus
Mono:453:SNORD18
GeneScaffold_3742
SNORD18
1001..1071
2071
TTGGCAGGGCTTAATGAAATGATTCTGGCCTATGGGCTAGACGTTCCCCATTCCTGGTC
TAATATTATCTCATGATATTCTTACTTACTTGTAAAAGGATCTTTTAGGGAGTTGGGCAC
AGTGGGTTGCACAAAGTGCAAGGACTGGCATATGGATCCCAGTTTGAGGCCCTGGCTCCC
CACCTGCAGGGGAGTCGCTTTACAAGCGGTGAAGCAGGTCTGCAGGTGTCTATCTTTCTG
TCCCCGTCTTCCCCTCCTCTGTCCATTTCTCTCTGTCCTATCCAACAACATCAATAACAA
CAACTACAACAATAAAAGGGCAAAAAAAAAAAAAAAAAGGAATAAATATTTTTAAAAAGG
GCTCTTTTAGTAGCCCTCCAAGCCAACAATTAGATATTTTAGGATCTAAGTCATCTAGAT
GACTTAACCCCCGCCCCCCCCACCCGGAGTTGTATGAGTGATTTCACTAATCCAAGGCTG
CTTTTTCTTTCTGACAGAAACAGAGACAGCACAGCACTAAAGCTTCCGTTGATCTTACTG
ACATTGATCTAAATTGCTTTAAAGACTTTCAGAACAAGGCACAAATAGTATTGCTCTCAC
CTCCATTTGCACATTGAAGACACCCCTTTTTTCTTCAATCTTTTCTTTAATAACAGCCAT
AGCTTGATTGAGAACAGAGAGACCTTCTGTTCTCTCCAAGGTTGTTGTAGTCATCACATA
CCGAGGAGGAGCTATTAGGTTAATCTAGGGAAAAATGACAGAAATCATACATGTACCTAC
AGAAAGTTTGATAATCAAAACTCACATTCTGTGGGCTGACAATATTGAGGGATATGCTCA
TGTAGCAAAACTGATATAGTAACCAAATCTAGCAGTTGTTTACAATAAATTACACTATAA
TTATATTCAGTGAGACAACGGCATCATCAAGGCCTTCAGGAACATCCCCGGTAACTGCCC
GGCCGGCGGTGTGGGGGGGTGTGCGGGGCGAGCTCGGACGGCCACGGTGATGAGCTTCCA
CCCATGGTCCGTGGTTTCTGAAACCCATGATTTCTGTGGAACTTCTGAGGCTCGGCATTT
AATTTTTAAAAAAAAAAATTATATTCAAGTGAACTAATTATTGACTTCTGGCTATCCTCT
GGTAGCTAGTCATAAACATCATTAGCTATTAGATGACCTGTGAGTACACAAAAATTCCTA
TTTGGTTCTAAACTAAAGAACATTTTATTTCACAGGGGCCGTGAGCACACATAAGTGCAA
AGAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACCAAAAGGGAAAA
AAAAAAAAATCACCTCAAAAAAAAAAATTCTGAGTAACCCCCCCAGTTAATTTTATCACT
GATAGAAGACTCACACCAGAGGTGTGGTTATGAAGTAGGAGCCGTTTTAGATCGCTTTCC
TCTTAAAACTAGAAAAAAAGCAACAACAAAAAAACATCACTGAATGCTTAAAATACAACT
GGGATTTCTTCAGAACCTCACTACGCCACAGTCACCAGGTTGCAGATGTTACTATAATTT
TATCCTGAACTCCCTCTCCCAAAACCTTGCCTCTCCAGGGCCCTACCCCACTAGGGAAAA
CAAACAAACAAACAAACAGGTTGGGGGTGTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved