Erinaceus_europaeus Locus Mono:462:SNORA17
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:462:SNORA17
Erinaceus_europaeus
Mono:462:SNORA17
GeneScaffold_5243
SNORA17
1001..1117
2117
TTTACATGTAGTTGATGTAGTGAAGATAAATCAAAGCCTACTTACTTTTCCACTAACTT
CACAGAAAACACATAGAAATGATTACAGTTCACAAGATAATGAACAGACTTGAACTTCAT
TAGAAAAATATACTACTAAAAAAAAAAAGAAAAAGATACTACTAACCAATCACTACCAGT
CTTTGAAGCAGCAATTGACACAAAACTGTTTTTTCTTTTCTTTTTTTTTTTAAATTTATT
TACTATTGGAGAGAGACAGAAAGAAACTGAGAGAGAAGGGGGACACAGAGAGTGAGTGAG
ACAGAGAGGAGGCTTCACCTCTCGTGAAGTTTCCCTCCTACAGATGGGGACCAGGGCCTT
GCACTTGGGTCCTTGCACACTGTAGTGTGTGCGCTTAACCAAGTGTGCCACCGCCGCCCC
TTTAACCTTGTTTTTCTGAAGAGAATATTCTTATAAGTGAGGGTTTGATACAGTAATGAT
AGAAATAAAGTCAGTAACAATATAACTTCCTTCACCTTCAAGAATCAAGAATCTAGGGTT
AAGAGCTCACTCACATGTGACCAAGAGAATGCATGTTGTATGGGAGGCCCTGGGTTCAAG
TTCTGATATAACAGGAGAGCACTATGAGCCAGTGGAACTCTGTAGATAGTGGAGTTATAG
TGTTCCTTCTCTATGTCTGGCTCTCTTCTCAAAAAGAAAAAAGGTTTGAAAGAATTGGTC
AGAGGAGACTGTTCACTGGCATAGCCTACGTGTGCAAGACTTTGGGTTAATTCCTCAGAG
TCACATAAATAAAAGTTAAAAATGTGTAAGGACCCGGTTCAAGTTCTAGTCTCCACATGC
AAGGGGAAAGCTTCAAGAGTAGTGAAGGCAAGTCTACAGATCTGTCTCTCTCTCTCTTCT
CTCTCTCCCCCTTCCCTTTGGATTTCTCTCTGTATCTATCCAACAAATAAATAGAAATTA
AAAAAAAGAAAATATATATACTTTTAAAAAGAAAGTGCTGGCCTGCCCCTAGAGGCATTA
CAGATGTGACTGCTGTGTCACATGTGTGTCATTAGGTGGCAGAGAGAAGAGAGGCTTGTC
TACATCCAGTGCCACTGGGTGATTGATAGTCTGACACTCAACACTGCGCCCCGCCTGTCA
CTACTGCCTGTTTATTGGCGACCTGAATCCTGTTGTATAAAAAAGCTCTTATTCTTCCTT
AGTTTTTGCCTGCCCTCAAGTCTCAAGGCAACCCTGTGACCTGAAGACTGGTGTTCATCA
CTGTTGGATGAAGAGTGATGGCTCACCATTCAAGGGGAAGGTGACTGTTAGCCTGTGACA
GTGACCTTATCGAATGTCTGACCTCTGTCCAAGCCCAGGTTACCAACCAGCCCAGCGTCC
AGAGGTGGTGTTAGATAATCTGAGAGAGCTGATCACCAAATGGTGCAGTGACCTTACCAG
ACAGACCAGTACCCCATCCTCAACCTTGTAGCAGATGCCAAGAGACCAGGAAAATGCTGG
AAGGCTACTCTGCATTCTCGAGGCATTTGCACAAATCATGGGGATCTACACCTGATCAAG
CTCAGGGCCTCACAGCACTAAGTACTCCCCCACTGCTCTACTGACTTGTAAAATAAATAA
ATAAATAAAAAATAAAAAGAAAGTGCTGGGAGATAGATATGAAGAGAACAAGTTTTTGTT
ATAGGTTTTTCTCTGCAGCAGAGTTCAAAACACAGCTCCAGTCACTTCAGATGTTGTGAT
GACACAAGAAACAAGCCTATAGTGCCAGTTTCAAATCCATCAAGAACTTTTCAATGTCTT
TTCAGTCTTTTGATATTTCCTTGGACTTCATTCTAGGCTCAGTCCCCAGTGAATTTGAAA
CTGCTCTAGGTTGTATGATATTAAATATGCTCAAACAGTGCCACAGCTATTTTAGAAGGT
TCTACAAAGTAGGCATTCTCTTCGTTTTTTATTTTGTTTATTTATTCTCCCTTTTGTTGC
CCTTGTTGTTTTATTGTTGTAGTTATTGTTGTTGTTATTGATGTCATCATTGTTAGATAG
GACAGAGAGAAATGGAGAGGGGGGGGAGAGAAAGATAGACACCTGCAGACCTACTTTTCA
CTGCCTGTGAAGCATCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved