Erinaceus_europaeus Locus Mono:370:SNORA55
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:370:SNORA55
Erinaceus_europaeus
Mono:370:SNORA55
scaffold_337826
SNORA55
1001..1123
2123
CCTGCTTCACCGCCTGTGAAGTGACTCCCCTGCAGATGGGGAGCCGGGGGCTCAAACCA
GGATCCTTATGCCGGTCCTTGTGCTTTGCACCACCTGCATTTAACCCCCTGCACTACTGC
CCGACTCCCTAATCTTTATTTTTAATGAGAGAGACAGACAGACAAATACCGGTGCACTGC
TGAGCTCTGGCTTATGGTGGTGCTGGGGAATGAACCTGGGACCTTAGAGCCTCGGGCGTA
AGCATCTTTTGCAAAACTAGTATGCTGTCTCCCCAGCCCACCACTCTGTTATCTATAGTA
TCTGTATTCTCACTCTACTCAAAAGCCTGTGCTACTCTGAGGATGATGAGCCTGGATCTA
AGCGGGGCATCAGGTAAAGCTGTGATGATGATGATGATGATGATGTAATAATGATCCTGA
CCAATTGAGGTCTTGTGAGCATGGACACACTAGCCCTGACTAATGGAGAGGTGGGGGCAG
TCTTGACAAAGCCTGCCCATGTTTACAAAGACACTGAGAGCAAGGCATACAAAGGCAGGA
GCAAATAAAAGCCTGGCTATGCAAAGAGGCCTCACCTCAAACAAAACAAACAAGTGATTC
TGATAACAAAGAGTACAAAAATAAATCAGTCTGTGAGGGCACCAACTTACATGCAAAAGG
GCCTAGAGATCCCAGGCTCATCTTTGCCAGAGATGAGCAGTACTCTGGTCCTCTCTCTCT
CTCTCTATTTTTTTTAACATTTTATGTAGCTTATTTTAATGAGAAAGAGTAGATACAGGG
GGAAAGATACTGAGAGAGAAATAGAAACCAGAACACTGCTCAGCTCTGGCTTATGGTGGG
GCTGGGGATTGAACATGGGACCTCAGAGCCTCAGGCTTGAAAGGCTTTTTGCATAACCAT
TATGCTGTCTCCCCAGCCCCTCTGGTCCTCTCTTTCCCTCTTTTCTCATTCTCTCTCTCT
CATAATAAAGAAATCTTTTTTAAAAAAAATCAGCACCAATTTGCATGAATCTTTTCCACT
CCTTGCTGTTTTGTGCAGGTGTGAGGACAGATATGAGCAGAAGAAATCCAGACAGGTTGT
TTTCCATTTGTCTTGGGACCTGTCTCTGTAATTCTGCCACACTAAAAAAAAAAAAAAAAA
AAAGGAAGTCGGGGAGGTAGCTCAGTGGGTTAAGCGTACATGGTACAAAGCACAAGGACC
GATGTAAGGAGTAAGGATCCCGGTTCTAGTCCCCTGCTCTCCACCTGCAGGGGAGTCGCT
TCACAGGTGGTGAAGCAGGTCTGCAGGTGTCTATCTTTCTCTCCCTTTGTCTTCCCCTCC
TCTCTACATTGTTCTCTGTCCTATCCAACAACGAACAACATCAACAACAACAATAATAAC
CACAAGGCTACAACAACAAGGACAACAAAAGGGGGAAAAAATGGCCTCCAGGACCAGTGG
ATTCATGGTGCAAGCACCGACCCCAGCAATAACCCTGAAGGCAAAAAAAAAAATCAGCAC
CCAGTTGAGAGCACGTTGCAATGAGTAAGCACCTAGGTACAAGTCCCCAGTCCCTACCTG
CAGAGAAAAAGTCGTGAAGCAGTGCTGCAGGTCTGTCTCCCTATCTTCCCCTTCCCTCTT
GATTCCTCTGTCTCTATCAAATAAATAAATAAATAAATAAATAAATAAATAGGGCAGGGG
TAGATAGCATAATGGTTATGCAACGAGACTCCCCTGCCTGAGGCTCAAAAGTCCCAGCCT
CAACCCCCTGCACCACCATAAGCCAGAACTCAGTAGTCCTCTGGTAAAATGATAATGATA
ATAGTAATAAATATATGCATGTATACATACATACCATGGTCCTGAAGCTTTGATTTTGGT
GAAAGCATAACTTAAAGAAAAGGGTACGGGGATACAACTGGAAGGTGGTGCAGTGGGTAA
TGTGTTAGACTCTCAAGCATGAGGTCACAAATTCAATCCACAGCATTACATGTGCTGGGC
TAGCTTCACGGGTGTTTCTTCCCAGGCACATGCTCTCTGGGTTGGAGAGAACTCAACCAG
AGCCAACCTGGGCTGCTGCTTACTCAGCAACATGGGAGAGAGACCAGGAACTCATGGTGG
AGTGGGAACACAATGCAATGCCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved