Erinaceus_europaeus Locus Mono:253:SNORA26
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:253:SNORA26
Erinaceus_europaeus
Mono:253:SNORA26
scaffold_305502
SNORA26
1001..1109
2109
TAGATCACACCTTGGTAACACCGAAAGAAGTGTGAATTGTATCATCCGAGCCATGAGAA
CCGCAGAAGCCTGGACCAAGGCGTGGCATCCATGTCTGCAGTGGGAAAATGTCTGTGGAG
TGACAGGATGGGCTTGAGGCAGAGTGCCCAGAACAGGGGGATGCTGTGCAGTCTTGCAGC
AGATAGCCACGGGGGGCTGGGGAGCAGCTAGCCCCCAGCTCTCCAGCACTTCTTACAGGG
AGGGGTGCGAACAGCATCTGAAGTCTCTGGAGGTCCATACATTCTATGGAGCTTTCAGGG
TTTTCAGCTTGGAGGCCCATGGCAGGAACAGCTACGGTTGAAGTTCAGGATGTCTTGCCC
TCTCCTGATTCAGATATTCCCAGAAAATATCGGTTGTGATATTTGTTTTTTTGTCTTCTA
TTACTGGGGAATTTCAGTTAAGAAGACTTGGATCTTTCACATAAGTAAATGCACATTGGC
CCGTGGTACAAAAGGAGGGATTATCTACAAATATCTACACACTGAGAAGAAGACTTATAC
TCAAACTTTCTCTGCAGGGAACCGGTTATACTAGAGGTCTGAGAATGCAGGATTCAGGGA
ATCATATTCAACATGTGCCTGTCATGCAGGTGGAGGGTGAAAATCAGCACTGCCCTCTCA
TCACTGACGTCACCTACATATGAAGGGCATGTCCATTATAACCTGGGCACAGTGGGTGCC
CAGCTTCCTCCACTGGCACTAGCACAAAGTTTCAGCTAAGCTGGTATTCCAACAACTTAT
CTGTATTTCATGCTTTCCGCCTGACAAGCATTCCAGAGCACCATCAGAGAACTCTAGGTT
AAAGAGCAAAACTAGGTTAAAGAAGCTGATGGCCTGATACAATCTCATTGTGAAGATGCC
AACATGTGAAAAAAAATGTCTTGGAAAAAGGTCTCAAAACAATGAATCTACACTTAAATT
TTATTTTTTTTTACACTTAAAAATTGATAATGCCCTTTTCTGTACACTTTTAAGGCTGAC
ACAGTCCTTTAAGAGACTTAACACTGAAGGGTAAATTTCCATAAAGTCCCAAGTAAGACT
GCTGTTTGGATCTTGTCTGAAGTGACAGTTGAAAACAGATACATGGATATGAAAAAGTTA
AAATACAAGCTCTCTTGTTGAGGTGGATGCAAACTGGCTTGGGATGAACAGTGAAGAGTC
AAGGAACTATCTGCTTGTCTAGGGGTAATGTGAAAAGCCAACTGGGCCCTCACAAAGCTG
TAAGAGGCTGCTGTCCCTCCCATGTCTGTGGAGCCTACGGTGTGTCAGACTCTGTGCTAA
GTAAGCATCACCCAGGCAAGGTGCTCTGAGCTGCAGGGGGCCCTTCCAGAGCTCCCACAG
AATGACAAGACACCTTGAGTCTCTGCAGCAACTGTTAAGTGTAACAGAGCAGAGGATGAT
GGCAGCTGGGCTCTGCCTAGGGAAACTGGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved