Erinaceus_europaeus Locus Mono:30:SNORA7
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:30:SNORA7
Erinaceus_europaeus
Mono:30:SNORA7
scaffold_377976
SNORA7
1001..1139
2139
TTCATTTCTTTAAATGAGCATTGGATTTTATAACTAGTTGATCTCTGATTTCATCATTG
GATTAGGTTAAAGAGAACTAGACTTTATGGTAATTCAGAACTCTTCTGTTTCTACATAAG
ATCCCACAATGTTACTTTCTTGTTGATCATTATTAAGTCACTAAATTTTAGTTCAGGCTA
GAACAGTGTTTGTTTGCAAAGGCAGTAAAGGTGTGGTAGAGATTTTTTTTTTTTTTTTGT
CTCTAGGTTATGGCACTTACTAGCTAGCTGAGACCAGTGGAGTTCAGCCTCCTTATCCCT
ATAATTAGAATAATAATATCTTTATTGTTCAGCTCATGAGTCATTATGAGATGAGATGGG
ATTCATAATATACAAAGTGTAAAGACCTTACTTACAAAGATCAGATTTATTGCCTTTGCC
TGTCATCTGTCAGAACCTAAGGAGATTTGGAAGTTTCTAATTGAGCTCTTTCAACCTATT
TGCTGTGTTGTTGATAGTATCCATGCTTATTTTTTTCTCAAAAGAGATTACATATATCAA
ACACATTTTACATTTTTTAGGTATTTAATAGCTCTTTCATAAACATTGTTTCCAGTTTTC
TCCTCCCAGTTCCTCAGCCATGCATTCTTCTTTTCCCCTGCTATTGCCCTTATTGTTCTT
TTTTTTTTTAATAGTTGTTGTGGTCATTATTATTATTATTGCTATCATTGTTGTTGGATA
GGACAGAGAGAAATTGAGAGAGAAGGGGAAGACAGAGAGGGGGAGAGAAAGACACCTTCA
CCGCTTGTGAAGTGACCCCCTTGCAGGTGGGTAGCCAGGGGCTGGAACCAGGATCCTTCA
GCCGGTCCTTGCGCTTTGTGCCATGTGCGCTTACCCCTCTGCACTACTGTCCGACCCCCT
GCACTCTTTTTTTATGATGGTAGTAGACCTTGCACATATGCATTGTACTATTGCCTGGCC
AAAAATTTTATTCTTTTTATTTCAAATAAAAAAAGAAAGAGCACCTACTCTCATCACATT
TGGAAAATGGTGGGTATTCTGCCTATTTAGGAGATGGGAGGGAGAGCAAGCCTGGTAGAG
GTACCCATCCCACTCCCAGGTTGCCAGTTGCTTGCAACTGGAAGATACTCTGTAACAGTA
CCTGAGGTTAAAAAAATAAAATAGAAATTAAATTTAAAAAAAAAAAGGAGACTGAGGATA
AAGATCATGATACCTTGGCTTCATACTTGAAGCTTTCCTTGCTGAACTTCATGGAAAGTT
CATAGGCTGTCAAGTTTCAGACATTGGTCTTAAGCACGGTTCTACCAAGTGAGCTGTTTC
TTGACTTCAAATGTGTACTCTCTGCAAATACATGGTGATGCAGCTTGTTGAGGGATTTTT
CTTTCCAAGTAAGCAGCATTAGGAATGTGTATTCAGGATATATTCTGCTAGGCACTATTA
TATTTATTTAATTCAGTTTTATATGCAAGGGAAACATTTGCTTCCGAGTCTAATTCAGAG
AAAATAATGTCAATTATTCCTCAGTAGGCTACCTAAAATCACCGTCAGATGAAACAAATT
ATATATGTTCAACTTTATTTCCTCATTTAATTTATTTTTATTGATATGCTATAAGAATAA
AAAAAATCCTTTCAGTGTCAATAGTAGTTTTTTTTTTTTTTAGCAGAAAAGTTGGGGGAG
TTAGGTGGTAGCGCAGCGGGTGGTGCAAAGCACAAGGACCTGTGTAAGGATCCCAGTTCG
AGCCCCAGGCTCCCCACCTGCAGGGAGGTTGCTTCACAGGCAGTGAAGCAGGTCTGCAGG
TGTCTATATATCTCTCCCTCTCTCTGTCTTCCCCTCCTCTCTCCATTTCTCTCTGTCCTA
TCCAACAATGACAACATCAATAACTACAACAATAAAACAAGGGCAACAAAAGAGAATAAA
AAAAAGCAGAAAGGTAATAAAATGTATTATTACTTTGGCTACACTTCCTTTTCATTCATT
TGTGAGAATTCTATCTTGTGGAAAAAAAGATGTAGACTGTGATTTTTGTGCCATCAGTAA
TTAGCAAGAGCAGCTTGATGCGAAACAGTGATGAGAGAATCAATGACAAACATCAATAAA
GCAAGACTCAAATGAGGTTTCTGGCTTTTATATTAGGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved