Erinaceus_europaeus Locus Mono:212:SNORA30
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:212:SNORA30
Erinaceus_europaeus
Mono:212:SNORA30
scaffold_288358
SNORA30
1001..1123
1325
CTCTTTGTATAACCATTATACTCTCTACCCCTGCCTGGTTCATTATTTTTAATATCTGA
GTAGTATATATATCACAACTTTCTCAGCCACTCATCTGTTGTTGGGCACCTGGGTTGTTT
CTGGGCTTTGGCTGTTACAAATTGTGCTGCTATGAATATAGGTGTACACTTATCTTTTTG
GATGGGTGTGACTTCTTAGGGTATATCCCTAGGAGAGGTATTACTGTGTCATAAGTAAGG
TCCATTTCTAGCCTTGTGAGGGTTCTCCAGACTGCTCTCCACAGGGGTTGGACCAATTTA
TATTCCCACCAGCAGTGCAGGAGGGCTCCTTTGTCCCTACAACCTCTCCAGCATTTGTTG
CTGCTGCCTTTTCTGATGTATGACAGTCTCACTGGGGTGAGGTAGTATCTCACTGTTGCA
TTTATTTGCATTTCTCTGACCATCAGTGACTTGGAACAATTCTTCATACGTCTGTTGACT
TTTTGTATCTCTTCTGTAGTGAATATTCTGTTCATATCCTCTCCTCCCTTTTGATTTGGG
TCATTTGCTTTCTTGTTGCAAAGTTTGGTGAGCTCTAGAACTCTTGCTGTTTATGTTCCC
CATCTCTATGTACAAGAACCCCCCCCCCCCAAAAAAAAAACAAAAAGAAACCCCAAGGCT
CCACCATATGTTTGAATATATATATATATGTGTGTGTGTGTATACTTATTTATTCCCTTT
TGTTGCCCTTGATATTTCATTGTTGTAGTTATTGTTGTTATTGATGTTGTCGTTGTTGGA
TAGGACAGAGAGAAATGGAGAGAGGAGGAGAAGACAGGGGAGAGAAAGACAGACACCTGC
AGACCCTCTTCACCGCCTGTGAAGCGACTCCCCTGCAGGTGGGGAGCCGGGTCTTGAACT
GGGATCCTTACACCAGTCCTTGCGCTTTGCGTCACGTGCACTTAACCTGCTGCGCTACCA
CCCGACTCCCTGTTTGAGTATATTTTAAAATCACTTGCTAACTAGCACTTTAACAGGCCC
CACATATTGGGGCCAGGATTGGTAGCTAGTGCTAAGAGAAAATCCTTGATTACATTTTTG
CCCTAGAACTGTTGCAGTGGCAGCTAACATTCAATGGGACACCATAAAGTTTAAAAAAAA
AAAAAAAGGAAAGTTTTATCAACAAGCTAAAATTCAAAGAGTAAGTTTTAATTTATTGTT
AAACTTTATCAGCTAATCAAATCAACTCATGGTTTCTGTGAAAAGTGTGTTTCATTATAG
ACATAGCTACCTGGATCAACTCATGCCATGAGGGAAATTATTTTCTTTGCTAAGGGAAAA
TCTAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved