Erinaceus_europaeus Locus Poly:2:SNORD41
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Poly:2:SNORD41
Erinaceus_europaeus
Poly:2:SNORD41
scaffold_258542
SNORD41, SNORD41
1001..1073, 1586..1659
2031
CCTGAGCGCCCCCTGGTCCTTGCAGGCTGTATGCAAGGACGGTGAACTACCTGCCGGAA
CTCATCCCACACCTCATCCAGTGCCTGGCCGACAAGAAGGCCTTGGTCCGCTCCATCGCC
TGCTGGACGCTCAGCCGCTATGCCCACTGGGTGGTCAGCCAGCCTCCCGACATGCACCTA
AAGCCCCTGATGACCGAGCTGCTCAAGCGGATCCTGGACGGCAACAAGCGGGTGCAGGAG
GCGGCCTGCAGGTGCGCCCGGCCCCGCCCACCGTGAGGCCTCGCCCACCGCGAGGCCCCT
CCCACAGAGCCTCGCCCACCGCAATGCCCCGCCCATAGAGCTCCGCCCACCACGAGGCCC
CGCCCATAGACCCCCCCCAGTGATGACAGTCCTGACGCTTGACCACGCAATGATTTCTGG
CGTATTCGTACTGACTGACCCGGGGGTGCCCCCTCTTTGTGCCAGCCCGCTTGCATGCCC
CCTGGACCCTGACCTGCCCTCCCTCCCACCCCAGTGCCTTCGCCACCCTGGAGGAGGAGG
CGTGCACGGAGCTGGTACCCTACCTCAGCTACATCCTGGACACCCTGGTCTTTGCCTTCG
GGAAATACCAGCACAAGAACCTGCTCATCCTCTACGACGCCATCGGCACGCTGGCCGACT
CGGTGGGCCACCACCTCAACCAGCCTGTGAGTGCCACCCGCGCCGCGCCAAAACCCACGG
GGACCCTGGGGGCGCGGAGAGCCCAGCCCTCCAGCACCACTTCCCTGCCCTCCACCCCCC
AGGAATATATCCAGAAGCTGATGCCACCGCTCATCCAGAAGTGGAACGAACTCAAGGATG
AGGACAAGGACCTGTTCCCGCTGCTGGAGGTGGGTCAGGCTGGCTGCCCCTGCCCCGCCC
AGGGCCGCGCCCCCCAGCCCCTCTCCCAGGGCGTATTCCCAGCCGTGGCCAGGGCCCCCG
GGAGGTGATGACACTCTGAACGCTTGATCACCGCAATGATTTCTCACTGAGTATTCGTAC
TGGCTGATCCCGGGGGCACCCAGTCTCCTGCTCCTGCTCCCTCTCCCCGCACCCACCACC
TGGCCTCGCCCCCTACCTCCTACCCTACACCGGTCCCGCTCCCCAGGTCACCCCCTTCCC
TCCCGCAGTGCCTGTCCTCGGGGGCCACCGCCCTGCAGAGCGGGCTTCCTGCCCTACTGC
GAGCCGGTCTACCAGCGCTGCGTGACCCTTGGTGCAGAAGACGCTGGCCCAGGCCATGGT
GAGTGTCTCCCCCTCCTGCGGGGGGCCCCCCCTTCTCTGTCTGCTGCTCCCCCCGTCCTC
ACCCCTGCCGTCTCTGCCCAGATGTACCACCCAGCACCCCGAGCAGTATGAGGCCCCCCG
AACAAGGACTTTCATGATCGTGGCCTCTGGAACCTGCTCAGTGGCCTGGGCCGAGGGGCT
GGGGCGGGCACGGTGGAGCAGCTGGTGGCTCGCAGTAACGTCATGACCACTCCTCTTCCA
GTGCATGCAGGGTCGGGGGGCCGGGCCGAAGGGCACCCTGGTATCTTGGGGAAGCGGGGC
TGGGGGGTGGGGGTGGGCAAGGCTGACCCCTCCCTCANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved