Erinaceus_europaeus Locus Mono:103:SNORA48
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:103:SNORA48
Erinaceus_europaeus
Mono:103:SNORA48
scaffold_310476
SNORA48
1001..1134
2134
TAACTCTTAGCAAAATCATAGGCTTTCACAGAAACAAAATTTCCCTACATCACTTAAAT
TTACCAGAACATTGTCATAATATCTTTCCTTTTCCCTTTCTCTCAAAATATACAAATGAA
AAAATGGGACCTGGGTGGTGACTTAGTAGTATCATAATGTGTAAGGCCCAGGGTTCTTAT
CCCAGCACTGAATGAAAAAAAGAATTGAATAGAGATGGATGAAGACTCTGATTCAGCCAG
TAACATGATTGCAGACGAGTAGATGTATGCCTACAAAAATACACCTATCTACCAAAAAGG
GAGAAACTTGCTCCCATTGAGAACAAGCAGAATGAAAGTTGGAGACATCAACCAAATGGG
TCTTTTGGCCGAGTAAGAGGCAAACAATGGTGCTGTGCTCTGTAGGAAGGCATGTGGTGG
GCATGGGAAGCAGGGTGAACTCCAAGGTTATCAGGTTGAAATCTGTAGCTAATATCAGCA
TTGGACTTTGGACAAATTTCATGGACAGCACTCAGATTTGACAGTGTTGACATTTCTAAG
AACAAGATCTTCACAACCATCATTACAAAGTTGAAAACCAGGGAGACAGCATAACGATTA
TGAAAAAAAGACTTTCTTGGAACCAGAGGTCTCCAGTTCAACCCAGGGCACCACCACCAG
CCAGAGCTAAACAGAGCTGGTCTGGAAGTTGGTTGAAGCAGGTTGTCCCTAGGTTATGTT
AGCAGTTGCTTCAACAAAGAGAAGTAGAAGTTCAGTGTCTGACTTGCATTTGGGTCAATC
TTGGGCATCTGTGCAGTCAAGAAATAATAATACCACATCAATCATATTGCCTTCATCAAG
AATGAAAGAGTGACCAGGGAGGGGCACAGTTGTAGAGTGTGGGACTTTTGTATTTGTAAG
GACCTGACTTCAACCCCCGGCATCTAATATACCAAAATGTTACTCTAGTTCCCTGTTTCT
CATTAGCAAATAAATATTTTCATAAAGTAAAATAAGTCCTGTGTCCCTGTCCTGGCTAGA
GTGACACCTACTTGGCTGTGTCCATCTCACGTCAGCCAGGAACAAAGAAAATTCCTTGTT
TATTCCAGCTTGGCTTTGCATCTATACCCGTCTGGTTCATGCCTTGGATATATATATATA
TATTTGCCTCATCCCTTTTTCTTGTAGGGCCTTATTTATTTATTTGCCATGGGTTGTCAG
TGGGGCTTAGTGCTTGTACTACTCCACTATTCCTGATGGCCATTTATATATATATATATA
TATATATATATATATATATATATATATATATATATATATATATAAAGGATGAGTGACAGA
CCTCTGTAGCACTGTTTTCACCACTCATGAAGCTGCCTCCCTGCAGGTGGGAACTGAAGA
CTTTTTTTTTTTAATGTTCTAAGGTTTCTTTTTTGTCTTTTTCCTTATTTATTTATTTAT
TTATTAGAAAGAGAGCAATTGAGAGGAGAAAGGGAGATAGACAGAGAAACATCTGCAGCT
CTGCCTCACCACTCGTGAAGCTTTCCCCCCTGCAGGTGGGGACCAGGGGCTTGAACCTGG
GTCCTCATGCACTGTAATGTGTGCGTTTCACTGGATGCACCACCGCCTGGCCCCCTGGAA
CTGAAGACTTGAACCCTGTCCTTGGACATGCTAACATGTGTGCCTTATGGGACGAGATAT
ATCACTGTCTGGCCCTTATAGAATCTTAAATATACAAATATTTAATATGTATATGTGTTG
CCTCTTTCATGCCTACTAAGCAAGTGGCCTTTAACCAGGGTGGCTGAGAGCCCAGTCATG
GGTCAGGTCTGGACCCCTTGAACTGCCCTTGCTCTGAAATACCTGCCTGTGCACCAGCTA
TCTGTCATTTCAAGAACTTAAAAAAGAAGTTACCTGGGGGGCCTGGGTAATTAAAGTGCA
TGTCTTACCACACCTGTGGCCCCAGGTTCAATTCTCAGCATCATATGGGTACACTGTGGG
CCGCTCCAGGTAGGCCTCCACGGATGGTGGAGTAAAAGCAGCCCTTGTTGTCTCTCCTTC
TTTCAAATCATAGCACAAAGATTGGATCAGGTGGGCAGCTCGTCATTGTTCTGCACACAC
AGGCTCTGGATTCATTCTTCAGTACTTCATAAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved