Erinaceus_europaeus Locus Mono:469:SNORD25
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:469:SNORD25
Erinaceus_europaeus
Mono:469:SNORD25
GeneScaffold_7093
SNORD25
1001..1070
2070
CACTGCCCTGGGCACATTCAGAGGAAGGATGTTGCCCATTCTCTGAACCTCATGGATGA
CAGCATTGGTGTAGGGCATAGACTCCCGAACAGCCATGTTGGGTGGTGACTGGCCAATCA
CTCTGTCGATCTCAGCTTGTACCTTTTCTGGAAAAGAGAAGGGTCTATTGTGTTTTGATT
CCATGACTTTCCTTGAGAATGGTTAAACCAGGGGACTGCTTCATAAAATTTGGCTAAAAG
TATAGCTCTTAGACTCTAGATTCTCAAGAAGGGTTTTGAGAACTCTGAGGTTAGACAAAT
CTGGCTATAAACTCTCTACAGCATTTTTGTCACAGTGTTCAAACTCTTTGAGAGTCTGAG
TCTTTACCTGTAAGGAGGTTTGGAGACTTATCTCAACTGATTTAGACAAGAAGGAGAGAG
AGATAGAGAGACAGAGACAGAGAGAGATAAATGGATAGAGAGAAATAGAAATTACTAATT
GGTCCCTAAAATCTGTTTTCTTCTTTATCTCCAATATTATTTTGACTTGCTACTTGGTTA
TCCAGCTAAAAACTACAACTCCTAGATTATCTAGTGAATCTATGTGATCCTTTAAGTTCT
GGATAACAGAATGGACCAAGAAGAGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNAGCTAAAAACTACATCTCGTAGATTATCTAGTGAATCTATGTGATCCTTCAA
GTTGCTGGATAACAGAGTCGAGCAAGAAGAGATGTTTAATACTTGCCTTGCATTAAAAGG
AAGGGTATATTACTCTTCCCCTTCACAGGTGGAAAGGTGAACCCTTTCTGATAGTACCAT
CTCTGTAGTATTGGGGCTTGAATTTGGACCATGTACATGGCTAACCATATACCCTGCCCA
GTGACTTATCTCACTAGATCAATGACAGAAAACTTAAAAGAATTCTCTGTGATGAGAATC
TTATCATAGACTTGTATCGAGATCCATGAGGATAAAACACTCTGAGGAGACGGTGCAAAA
ACAAACAAGCAAAAAAATATAGTTGTTTTCCTGTCTTTCTATTCTATTCTGTCATGCTCT
CTTCTGCCTTCTACTTTGAGGACACACAGTCCAGAAGGCACTTTTCAGTGCTGATTCGCT
GATGCTCACCTTGGACTTCTGGATTGAGGGCCATGTAAAGCAGACCCCAGCGCAACGTTG
TCGAAGTTGTCTCAGTTCCCGCAAAGAAGAGGTCCAGAGTGGAACAGATGAGATTTTCTT
CATTGAAACTTGAACTGGTGTCACTCTTATGCTAGAAAGCACAATGTTTACTGATGTATT
CTATGAGTTCATTTACCTCAAGACAGAGATTTCAGTCAAGAATATGAAAGGAAGTATTCC
GAGGACTAATAGTGTCCCCTTCAGGTACCTTATGGCTGTTAATAATTAGTCACGTCATGT
CATTGTCTTGACCAAGAGATAGATAGCTTGGGTGGATAAAAACCAAGGCATTTATTTTCT
TCCTTCTTTCCTTTTTTTTTTTCCCTTCCTTCGTCCTTCCTCCTTCCTTTAACTGTTTCT
TTTTAAACATTTAAATTTATTTATTTATTTATTATTGGATAGAGTCAGAAAAAACTGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTAATCAGAATTTTTTCTAAG
ATACAATCAGGAAGGTCATGAAGGGAAGTTGTAATGATGGTAGTAGGTAAGTTGCTTCTG
ATTTTCAAGAAAGAATGAGGGGACATGAAGTTAGAAAAATTAAGGAACTAGATTCTTCAC
TGTGCCCGCCCCCTGACAAAAAAAAAAAATCTTCTGAAGTATCTAGCCCTATCAGCATAT
CAATTTTTAGCCCAGTGAAACTGGTTTTAGATTTTTGGTCTGAATAACTATAAGATAATA
AATTTGTTTTGTGTTAAATCACTGGGTTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved