Erinaceus_europaeus Locus Poly:12:SNORA63
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Poly:12:SNORA63
Erinaceus_europaeus
Poly:12:SNORA63
GeneScaffold_861
SNORA63, SNORA63
1001..1131, 1989..2116
3116
TTATTGCTGGGGCTCGGTGCCTACACTATGAATCCACTGCTCCTATTTTGTTGCCCTTG
TTGTTACCATTGTAGTTGTTATGATTGTTGTCACTGCTGTTGTTGTCAGATAGGACAAAA
AGAAATCAAGAGAGGAGGGGAGACAGAAAGGGAGAGAGAAAGACAGACACCTACAGACCT
GCTTTGCCACTAGTGAAGCGACCCCTGCAGGTGGGGAGCCTGGGCCTCGAACCTGGATCC
TTACTCCAGTCCTTGCGCTTCATGCCATGTGTGCTTAACCCGCTGCGCCACTGCCCAGCA
CCTGACATTGACAGTTTTTATGTGTATGAACATCAGATATTTAGGGACAGCCTGTCTATT
GAAATTATTCGTTTATTCTTGCAAAATTAGATTGGGGGTATGGGTTCGGGGGGAAGAAGA
GCACAGAAGTAGAATGTCATTGTCATTGCATTTTATCTAAGATTATAGCTGTTGCTGTTG
ACCCCTCCCCCCCCAAACTGTCAGATTTGTTTGTTTGTTTTATTTTGTCTTTGCCACCAG
GCTTATCACTGCGGCTCTGTGACTACACCACAACCCCACTCTTCCTGTGGCCATTTCTTT
TTCTTTTCCTTACATTTCTGAGTGAGAAAGAGGAAAATATGGAGTAAGACAAAGGAACAG
TAGAAGAGAGAAAGAAAGACACCTGTAGCACTGCTCCACTGTTCGTGAAGCTTCCCCTCA
GCAAGTGGAGACCAGGGACTTGAACCCCAGTCCTTACACATGGTAACATGTGAACTCTAC
CAGAAGAATACCACCACCTGGCCCTCCCACACTGTAGTCTTTTAAAAGAAGTCTTTATGT
GCAGCCCACACATTTTCACTTTCCAAAATGGGTCAAGATGCTGGTTACTAATGAAGCAGA
TAAAGATATAGAACCAGGGGGTTCACAGTCAGATCTGGAGATTTTCCCAGAATTCATTCA
GTGGCAAGTATTCAGGTACACAGGACTTTTCTGTAACTGGCAGGTCGGGATAATTGTTAC
AGTATAGCTGTCAAGTGCTATATTGTCCCACCCCCTGCTGAAAGTAAGTGTTTCCTACAA
TCTCTGTCTAGCTCAGTTCTATAGTGAGACAGGGACGCTTGGTCTCAAACATTATTTCCC
GCAGCAGGATTATGAAAAGTGTTCTCTCTGCTCCTTGGTGCATTGATGTCACTAGCCATC
TCTTTCAAGGGTTGTGTTGCTTTCTGCCGACGTGCTAATTGATAAGTTGAATGTCATCTA
AAAGTTCATGAGAGCCATTTCAAATTTACTGAAGAAGGAAGAAGCAACCCTGGATAGAGT
TGATATCTTATTTCATTTGCAGCCGGGGCACTCCTATGAGGTGTCTTAACTAAAACCTGG
AGCACACATGGCAAGACACATGTGCTGCCCAGTGAGCTGTCTCTGGCCCTGCAGATCAGT
CATATATGTAAACTTTGGCAGAGGGTCATGTTCTCCTGATTGATACACGATATTGTTCAG
ATCTTTTTTTTTAACCTTATTTAAACTCTGTGCTAAAATCGCAGAAACTAGTACTATGTC
TTAGTATTTTTAATAAAGCAAGCAGAGAACCCAAGAGGACGGGAGGACAGTCCAGGTAGT
TGAAAACCTGAGATGAATCTCTTCCAGGGTGTTTGCTTCTAAGACTCGGTACAATCCTGT
CTGTAGCTAGGCAGAGTTAATAAAATGAATGTCTGGTTTCCTCTCCCAGCTAGTAAGAAT
GGAATTAGACATCAAATAGCCTTTTTCTAGTGATATGAGTTAACATTTTCATCTCTGAAA
TACTACAGGGAAGGAAATTCTATGCCCTTTGTGAGCTTACTGACCATCATATGGGATGAT
GTTCTTTTTCCAAAACACAAGGCACTGGCTTTTGAAAACACACTGGTGGGGAATTTCCGT
CTCTGGTGTGGTAAGAACTTCTCTTCTGTAGTATTGCTGTTACTGAGTGTTTGGTTCTGT
AATAACTGGATGCAGGATACTTACAATGTAGCTGTGAAGTGCTGCATTGCCTTTGCCCCC
TGCTTAAAGCATAGTTGGTACCGTCCTAGCCCTGGCCCTGGTAATATACCCTGCCAGGGA
TGCACGGTGTCACACAGGTTTACTGACTGAAACACAGGCTTGACAGGTGACTCTGGAGAA
CTGAGACTTGCTACTATGTTGCAGGTGGTGGAAGAAGGAAAGAGACACTCTCCTGCAGGA
ATTGAGGTAAGGGATGAACCGTGTCTTGATTACTGCTGATTTAATGGTCTTTCACTTTCC
TTTGTGGTTACAATTTTCATCTCCCAGAAGTTGCACTATATGGGGAAGATATATTTTTAA
TTTTTATTTATTTATTTATTATTGGATAGAGACAGAGATAAATTGAGAGGAGAGGGGAGA
TAGTGAGGGAGAGAGACAGAGAGACACCTGCAGCCCTGCTTCACCGCTCTTGAAGCCTTC
CTTCTCCCTGCAGGTGGGGACCAGGGACTTGAACCTGGGTCCTTGTGCACTGTCCTGTGT
GCGCTTAACCAGGTGTGCCACCACCTGGCCCTGATATGTTTTTTAGTCATTTTGAATATA
ACCTACATTTTTTTATTACTGATTTAGTAATAATCAAGACTGTAGGGATAAGAGGGGTGT
AATCCCACACAATTCCCACCACCAGATTTCTGTATTTCCCCTCCATGGGAAGCTTTCCTA
TTACTGGGGAAGACATATTTATTAGTGAAGTAATAGTGGTTTCTGGAGTCCTCAGATTTC
AGGGGTAGCATGTCACACACACATGCCCCACCAATATTCTGTGTAGCCCTATACCCCCGC
CCAGTAACCACCGCAGCTCTCACAAAGTCTGAGGGAGTTTGGCTACTTTTTGCTGGTTTG
TGTGCTTTAATCCTCTATATTCCACAGATGAGCAAAAATCTCTTCTTTCACTTCGCATAA
TTCCAGCTCCATCTGTCTTGTCCCAAAAGACACAATGTTCTTTTATTATTATTATTATTA
TTATTATATTTATTTCTTTATTGGCTAGAAACAGCCAGGAATCAAGAGGGAGGAGAGTGA
AAGAGAGGGAGAGAGACAGACACCTGCCACACTGCTTCACCACTTGCAAAGCTTTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved