Erinaceus_europaeus Locus Mono:310:SNORA32
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:310:SNORA32
Erinaceus_europaeus
Mono:310:SNORA32
scaffold_377048
SNORA32
1001..1120
2120
GACAAATAAAAAAAATAAATAAACAAAAAGACATGGAATTTCAGAATGGTGATTTATCT
ATATAAATACTTTAAATTGGTGGTACTAAAAATTCATGTTATAAAAGCAAATTTCAAATC
CCGCCCTCTCTCTTTGCCTCTATCTTCCTCTGCTTCATGATTATTGGAATTGTAGCCCAC
AACCATCAGTGAAGAATATCTGAATTTCCAAAACACCCTTATTTTTTTTTTCACAGTGAT
CCTTAGTTGTTTTGAAATTTCAGGATAATTAGAATCTACAAATTTCCAAGTTTAGATTTT
ACTCTAAGTACAATATTCTCTCAACACTGAATCATAATGTAGGTTTATGTTCATGGAATA
CACTTTTGTTTTTCTTAGCAGCCTGTTTTGCTCCTCTCTGATTTACTCCATCAGTTACTC
AAGATCTCAGTTTTATTGCCTTACTTTCAACACAGTTTAGTTTAGTGGCAGACCCATTTC
AGTATTGAAACTACTCTTCTGGACAATAAACATCAAAGACTTAAGATCTTTCTAGGTGAT
ATCCCTGAGAGTCAAACTTACCCTCTATCCTCTCCAACCTGACCACATCTTAAAGTTGTG
TAAGGTTCAGTTTCCGATAAAACAGTAGTACAATTATGTGCCTAGCTGAAATACTGTAGA
CAAACGTATTTGGTCAATATACATTAACACTTGGGGACAATATTGAGAACTTCTGGGAGC
TACGTGTCGGTCGGGTTGATGTGTTCACTTGATGTAGAGCTGGTATTATCTGCATATAAC
TGGCCAACTTACATGACATACAGAAAATGTGAATTATGAGACACAAGAAAATATATTAAA
AACTCTATTTTTGCATTTCAAGCAGATAAATTCAGGAGATTAACTCTGACTATATTTTTA
TGTACTAACTGTTGAAAACAGAGTAGTAAAAGAGAGAAGGTAGTATTTTGGCAGACAGAT
TACTTGAAAGAAGTGTTTTTTTAAAAAAAATCCCATGTTACAAGTCATTACCAAGGCTTT
TAGAATGTGGTTTCTTGTTTGCTGTGGATGTGACCTTAAAGAAACGCCCACTAGGTTTGT
TTGCTGCTACAATGGTAACATTCATCCTTGTGGGAACATTTTGAAAAAAAAAAAAAGTTA
AAACAATAATCCCATGTTTATAAGGCTAGATCTTTATGTGTCCTTGACATCCCAAACTAT
TAAATTTGCTAATATGTCAAAAAGTTAAATGATGGTATGAGTGTATGTATTTATCACTAC
TTTTTTTTTCTCCAGTTACAGTATGTCTTAACTAGTGTACAATCTTTTGGAAACTAACTT
TTAGTAATCTTATTTCCTTATGTGACAATTGGTATACTTTGTAGTACTTTCCTAGAAAGA
AAATAAAATGGTCCCTAAACATTTTCTTCCAGTGAAACACAAAAGGATAATCATTGAGTG
ACTCCACAACTTCAGATTCCTAGAGTAACCACCTTCATGGAAACAGAAAATAGAGTTGTA
GTTACCAGGATCCGAAGGGAACAGAGAATGAGAAATTACAGCTGAAGAGGTGCAGAGTTT
GAGATTTGAAAAGAAAGATGATCTGGAGACCGAAGCTGAGGATGGCTGTGCTGAGGTTAG
AGTGTCTTTGGTACATGGAGCTCTAACCTAAAAATTCTTAAAGTGACACATTTTTTGTTA
TATCAAGCTAGTTTAATTTTGTTTTATGATTTATTTTTTCCAGGATCAAAATAAATAGTC
TTCATGTTTTCTTTTCTAAGAAGCATTTTCCACTACTTTAAAAAATTTAAATTCTAAAAA
AGATAAAAAATAAGTCATGCAAGCCATAATACCCTCGATAATACTATTTAAAGAATAAAC
AGATTATTTCAATTTTTTCCTTGTTTACCTTATCATTGCATTTTTTTTTCTCTCACTGTC
CTAATTAATGTTGAAAATTGAAACTTCCCTGGGTCAATTTATAAACATCAATGTCTTACA
ACACTAGTTTACTTTTTACGGTCGTATATAGCATACATATGCAACACTTATTTAATAACC
CCATATTATTCAGTTTTTACATCATTTCCAGAAATTTTTTTTTCTATTTTTATTACCACC
AGGATTGTTGCTGAGACTCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved