Erinaceus_europaeus Locus Mono:499:SNORA3
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:499:SNORA3
Erinaceus_europaeus
Mono:499:SNORA3
GeneScaffold_8874
SNORA3
1001..1127
2127
GACCACGCTCCCCACCTGCAGGGGGGTCGCTTCACAGGCAATGAAGCAGGTCTGCAGGT
GTCTATCTTTCAGGTCTGCAGGTATTCTTCCCCTCTCTATCTTCCCATCATCTCCCGATT
TCTGTCTGTCCTATACAACAACAACAGTAACAACAACAACAACAATAAACAACAAAGGCA
ACAAAAGGGAAAAAATTTAAAGGATATTGACCTTCTATAGAGCTTTTAACAAAATTTTAA
TAACTTAAATTTTCTATGGGGCCAGGCAGAGGGCACCTGGTTAAGCACACACATTACAAT
GCATAAGGACCTGGGTTCAAGCCCCTGGTCCCCACCTGCAGGGAAAAAGTGTCACAAGTG
GTTAAGCAGGGCTGCAGGTATCTTATCTCCTTTCCTCTCTCTATCTGCCTCACCTTCTCA
ATTTCTGTCTCCATCCAATAATAAATAAATACAAAGATTAAAAAGAAAAAAGAATTTTAA
AAAATGTTTTCTAACTATTGAACTATTAGAGTTGTTTTAATTAATTCTGAAACTACGCAG
TGTAGAAATTAAAATTTCACAATACTCGTTCTAATGAGTTAGAGCCAGAGAAGTTTCACA
GTTGTTTATATTGCTATTCATGCCAGACCGCAGTTAATAAAATTTAGATATTTATATGAA
TGAGGGATTCTTAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATC
TATCTTTCTCTCCCCCTCTCTATCTTCCCCTCCTCTCTCCATTTCTCTCTGTCCTATCCA
ACAATGACGACATCAGTAACAACAATAATAACTACAACAATAAAACAACAAAGGCAGCCA
AAGGGAATAAATAAGTAAATATTTTTTAAAAGTCTTTAAAAAAAAATAAAAAGAATGACT
AGGGTGAAGGAGATAACATAATGGTTATGAAAAAAACTTCCGGCGAGGCTGGAGTCTCGC
CCGGACATGGTGTTGCACCGGCGTGCTAGAGTCCTTGGAGAGCAGCCGCTGGCCTTATTC
ACTGGCTGCGGCCCCGTGGCCGAGCCGGTCACCAGGCAAGGGACAAGCGGGTGGGCGTCC
CCGGCTGATGTCCAGAGAGCCGGGTGGATGGGTTGTGAGTGGTACCCACCCTTCCAGCCA
CCCAGGCTACTTTGGTAAGGTCGGCATGCGCCATTACCACCTGAAAAAGAATCAGCTTCT
GGCCGACTGTCAACCTGGATAAGCTGTGGACCCTGATCAGCAGCAGACGTGGGTCAAGGC
AGCCAAGAACCCAGCCGGGGCTGCCCCTCCCCCCCATCATCGAAGTGGTGCGGTTGGGCT
TCTACAAAGTCCTGGGGGGAAGACAAGCTCCCTAAGCAGCCTGTCATCGTGAAGGCCAAA
TTCTTCAGTAGAAGAGCTGAGGAGAAGATCAAAGGTGTTGGCGGAGCCTGCGTCCTGGTG
GCTTGAAACCACAAGGGAAGGTTCATTAAGCGCCATGAATGTGGCTGTGGTCTGAGTGAT
TCTTCTGACACCTTGCCTTCCTCACACATGCCACCTTTTAAGGCCCTTGGTTTGAGCTGC
TATGTAACTTGAACTTTCACTTGTAAAATGAGATGTTATAAAGACCTATAAGCTATATTT
GACACAAAAAAAAAAAAAAAAAGAAAAAAACTTCCAAGCCTGAGGCTCCAAAGTACAAGG
TTCAATCCCCCACATCACTAACCTATAGTTGAGCAGTGCTCTAGTCTCTTTTTATATATA
TTAAAATAAAACAAATAAAATATATAATAATAATAATAATGGGTAAGGTGGGAGCTAGGA
GTCTGCTCACCCTATAGAGTGCAAACCTTACCATGGATGAGAACCTATATTCAAGATCCC
AATCACAGTACTGGGGCATCATGTAAAGAGAAAGTTTCACAAGTAGCAGAGTAATGTGTT
ATTTCTCCTCTCTCTGGCTTGCGCCCTCCCCTGCCCCTTACCCTCTATCTAGAAAAAAGA
AACAGAAAAGGGAAACAGAAAAAGGAAAAAGAGTCCACAGGAAGTGGTACAATCAAGTAG
ATTTGAGGCCCTGGTAGAAAATCAAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved