Erinaceus_europaeus Locus Mono:183:SNORD96
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:183:SNORD96
Erinaceus_europaeus
Mono:183:SNORD96
scaffold_374619
SNORD96
1001..1081
2081
CACTTTTGGGCAGTGTCTCCAAATTCACCTCACAAAAAACTCCAGTCGTTTCTGGCCCC
CATACTGGCAATGGATTTCGCTAGGCAACATAGCCTATGTTCTAATGTTGCTGAAACCAT
CCCAATATCTCACATTCTACTTGTCTCTATAATCCACCAAAATACTCCAGAAATTACAAT
ATTTTGGTACACAAGCTATATCTACAAGACAACTTTTCACACTAGAGAGGAATTCAAAAA
TTCATCTTGAGGGAGTCGGGCAGTAACACAGTGGGTTAAGTGCACGTGGCTCGAAGAACA
AGGACCTGCATAAGGATCCCAGTTCGAGCCCCCAGATCCCCACCTGCAGGGGAGTCGCTT
CACAGGCGGTGAAGCAGGTCTGCAGGTAACTATCTTTCTCTCCCCCCTGTCTTCCCCTCT
TCTCTCCATTTCTCTCTGTCCTATCTAACAACGATGGCATCAATAACAACAACAACAATA
AATACAACAATAATAATAAATAACAAGGGCTTTTTTAAAGGAAAATAAATAAATAAATAT
AAAAAAATTTTTTTTAATCTTGAGAACTTGCACCTTAATTTTAAGTTGAAACTCATTCAC
TTTGTCCACATCTACCAACAGACTTTATAATGTGCAGTTTATTTCTCTCCTGGGGACATC
TTACCAAGAAGCCTGCCTCCCTTCAGAAGGTGCTCTCATTCAGAAGTTATGTACTGGGAT
CATTCATTCTTTACCAAAAAAAAAAAAAAAAAAAAATTTCTGCTTAACTTACCACTAACT
AGCACAAGTAAAACACAAGTAGAGCCTGAACTGGAATTGGCATATTGCACCACAGTAAAA
GACTTGGGGGGGGGGGGGAGAATACAGATCCAAAAAGGATGACAGAGGACCTAGTGGGGG
TTGTATTATTCTATGGAAAACTGGGAAATGTTATGCATGTACAAACTATTATATTTATGG
TCAAACGTAAAACATTAATTCCCCAATAAAGAAATTTAAAAGATCCTGATGATGATAATA
AGACATTGTTAACCTGATCCCCACGTGGGGTTGAGGACAAGTCCTGCAATTCTGAAAGGG
TTCTCTATAGAAAAAAAAAAAAAAAAGAAATTTAAAAGAGAGAGAGGAGAGGAAAGAAAA
AAAAAACTAGAACATCCCAGGGCATTTGAGGGGATAAACAGAAAGTATGGAGATATCACT
TTGCTCCTGAGCAGTTCTGGCAGAATATATGGCGCCCTTCAGTTTTCAACTAACTGGACA
GGTTTGGGTTATTGCTGTGGCTCAGTGCTGGCACCACAAATCCACCTCTCCTGGCAGCCT
TCCCCCCCCCCCCATTTTTATTGGATAGGCCACATTCCTCATTCGGAGAGGATCCACATC
AGTGAGTGATGAGGCTGAAAGGAGGGAACTTCTGACTTACACCACAACTACCCTTGCATC
TACGTTTCAGTTCACACCCACACCTATATCTGTTCTCCTGCTCTGATTATGACATGGTGA
TGATAATGATGGTGATGATGGTGGAAATAATCATGTCGCCAAATTATTATAGCTTCTGGG
ACGCAGTCTGATTCGAAGTGGGTGAAAGCTCACAGTGGACATCAGCCTACTCTGTACAAA
GTCCAACTAGATCATTAGTAGATGTTTGACCCAGAAAGGCCCTGAGCTTCTTCGGACCTT
GATCCCCTGTAATATGATAATCAGAAGAGCGCCTACTTATGAGACCACTATGGCAAATAA
ACTTACGACAAATGCAAGATGCAATTTTAGAGTGATTTGGAGGTGTAAGTTAATAAGCTT
GATTCTCAAATGTATTAGAAAGTAAACTCTCGATAATTATTGATTCAATGAATGTAATAA
TGAATTAATGAATGACACACTAGAGACACCTGGGCAAAATATTCGTGACTGATAAATTCT
GTGCAGGGTGAGTTTGCGAAGAGAATGCTGAGACTTAGGATGACGCAGAGTCTTAAATTG
AGAGGAACTTTCAGAAGAGAAATAAATAGGGGCTGGGCATTAGTGCACCCAGTTAAGCGC
ACATAATATGAAGCACAAGGACCCACGCAAGGATCCCGGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved