Erinaceus_europaeus Locus Mono:427:SNORD12
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:427:SNORD12
Erinaceus_europaeus
Mono:427:SNORD12
GeneScaffold_7077
SNORD12
1001..1080
2080
TAATGTGTGAACATAACCAGCTGCACCACCACCTGGCCCCTACTAGATAAAATTTTGGT
TCTTCGTTTCCACTATGTATTTTTTCAAGCTACTCCAATTCCTTGGCCTAACCAGCCTTC
TGATCTCATGTCAACTTTCCTAGCTGAGAAGACAGCCTCTTCTCTGTAATACCATCTGAA
GAAAGCCTTTATAGCACACTGGAGGAGAGTTTACCTGCATCATCACTGCTCTATGTGTGG
TCCTGACCCAGCAGCACAGGCATCACTTGGAAGCTTGTCAGAAAAGCAGAAACTCACACT
CTATCCTAGAACTACTGAGTTAGAATTTGCAATTTAGCAAGGCACCCTCTGTGTAAATAA
AAACTTGACAAACATTATCCAGGTCCTAGTAATCAGTAATAAAGAGAGTAGATTTGGGGA
AAGCAATACAGTACTGGATTCCACAAATCTTGAAAAGTTTTTTTAAAAAAGATTTTGTTT
ATCTGTTGGATAGAGACAGAGAGAGATTGAGAGGGAAGTAGAGCTAGAGAAACAGAGACA
CCTGAAGCACTGCTTCACTGCTTGTGGAGCTTCTCCTCTGCAGGTATAGACCAGAAGCTT
GCCTGGGCCCTTGAGCATTGTCACATCTGCCTTGAAACAGGTACAATGCTGTCCAGTCCT
TGAAAAAAAGACTAATCCTCCCAGTGAGAATTTACCTCTGGTGTGAGGTCCTGAAAGGTT
CCCGGTGTTAATACGCTGAGTCCAGAGGAAGTATTTATCAGTATGCCAAAGGGTTCCTGT
TTATTTCTAAAATTGTGCTATTGGGTTGCCAGAAAATTTATGATGTTTTCTTCTATGCAA
AAATGTGTGATGATTTTTTCTACAACCCAACAGATTTATGGAGGACAGATTTCTTGGGTC
TAAGTACTCTTTAATTTGGCTGTGTAATGAGCCTGTTTTATGGCACTCAGTCACTCACAG
AGACAAATTAAGAGTTGACTCTTTTACAGAAGGAGCTCAAAGTAGAAAATGCAAAGATAC
CCCATCAGATCGACCCTATTGATCTTATTAACCGTAAGCCAGTTTTGTCTGATGCAAAAA
AAAAAAAAAGATACATATGTACTTTTTTCTGTTATTACCAGATATTTTTATTGGTTTAAG
TTATTTTGTCCTTTCATCCCCAAACCTACCCTGTTATTACTATTTTTAAAAATATTTTAG
GGTTAAACGTATGATTTTATTTAGATGTTAACTTGTACATAATCTATAATAAGATATATA
AACGGATAAAATTGTTTAACAGGCATTTTTAATACCACTTTAAATTCAGTTTACAACAGT
ACTGATAATATTGCAAGATAACAAATACTCTTTTTGATTTATAAAACAAAAATTACTTGC
TACTCTGGCTGATACATTCCCACTAGTCTTTAATGGATTAAAATGCATCATGTATTTCCA
TTGCAAATCATTACAAAACTTTCACAACCTAGCCATTCTGTGCTTAGCAAAGATTTGAAT
ATTCTAAAAATAACATTCTGAGATAAAATATTAATTCTCTAGCAGAATATGTACTAAGGA
AAAAAACCGAAGTACACCAAATGTGCTGGTTTGTGGTTTACAACAGAAAATCATTTGTGT
AACTAATGGGTAGTGCATTGTCCTACCCTCTTTGCCTAAATATGTGATTTTTTTTTTTTT
AATGCTTGTTAGTGAGACATGGACTGGACATGGTGTATTGCACCAAAGCAAAGGACTCTG
GGAGAGGAGGAGGGAGGAGAGGAAGAAAACTTTGGGAGCCTAGTACATAGTGAAACTGTA
TGCATATGTCAATGACTGTACTATAAAGCATTAACTTCTAAAATACTTATTAAGAAGTAA
TCTAGGGAGTCGGGAGGTAAGCACAAGGACTGGAATGAGGAACCCAGTTAGAGCCCCCAG
CTCCCCACCTGCAGAGGAGTCTCTTCATAAGCGGTGAAGCAGGTCTGCAGGTGTCTGTCT
TTCTCTCCCTCCTCTCTGTCTCCCCCTCCTGTCTCCACTTCTCTCTGTCCTATCCATCGA
TGACATCAACAATAATAACTACAACAACAATAAAAATAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved