Erinaceus_europaeus Locus Mono:214:SNORA73
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:214:SNORA73
Erinaceus_europaeus
Mono:214:SNORA73
scaffold_360891
SNORA73
1001..1206
2206
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAG
AGAGAGGAAATGACTGGAACATTGTGCCAGTCTAAGCACTTCTAAAGCACTGTGCCATCT
TCTAAGCACATGAGCACACCAGATCTTCATAAAATTCTAGGAGAGAGTCCACTCATCTTC
CCAGTTTATAAAAGATGTTCCTAAATTTTAGAAGCTAAACTGAAAATTACAGTCTGAAAT
TAAGTTCTGAAATCTATCAACACATCCAGCTGACTGTTTCAGCTGAAAACTACTCACACA
AAGTCAGTACTCAACCCAGTTGCTGTAAAGACAATATAAAATACATATATATGTACATAT
TTTAATGAGAGGTTCAGAGAAAGAAAAACAGACACTAGAGCACTGCTCAGCTCTGACTTA
TGGTAACGCCAGGGATTGAATTTGGGACCTCAAAGCCTCAGGCATCAATGTCTGATACAG
AACAATTATGTTATCTTTCTAGTAATGTAAATGTTTTTTCACCAATGTGGACAGCCCCTG
GGTTCTCCCAAGGGCTCTCCAGGTGGCCCAGAGGGGCACCGCACCGCAGTGCAGTGGTGT
AGAGTCCTGTCCCACAACACTGGAGATGATGTTGTCCCCAGTCTTGGACTGCTGAGGACA
TGTCCTGTATATTCCTTATCTTTTCAGTGTCTAGTCGCTGAGGAGAAAAACCATACAGGG
CACAATTTCATAAAAAATAAATAAATAAAGTTTTTTCTTAGAATAGTCTTGTACCTTATT
GATTTGTTCATCACAGAACTTAAGAAATAGAGAAACCCAGTTAAAACAATGTAGCATCAT
CTCTGACTTATTCAAATTTACATTGTATTACAAATCTTTGGGGTGAGGTTGAGTGCAAAT
GTTGTAATGTTTAGGGTCCCAGGTTCAAGCCTCCAGTCCCCACCTACAGTGGGGATGCTT
CCAGAGCAGTGAAGTAGTGCCCAATTGGCTCTGTCTCTCTCCCTCTCTATCTCGTTTTCC
CTTCTCAATTTCTCTGTGTACAAAATACATAAATACACGAATACATAAATAAGTAAATAA
AGCTTTAAGAGAAGGAAAGAAATCTGTGCAATAAATTATTTGAACTAAGAAATTTGTGTT
CTCGTATTCCACCAAAGTAAAAGACTCTAGGGTGGGTGGGGGTGGGGGTTCAGGTCCTGG
AACATGATGTCAAAAGACCTAGTGGGGTTGTATTGTTATGTGGAAAACTAGGAAATGTTA
TGCATGTACAAATTATTGTATTTACTGTCGACTATAAACCACTAATTCCCCAACAAAGAA
ATTTTTTAAAAAGACATTTATGATCTGATGATAGTTCTTGAATCATTTTGGTAGTCTTTA
TGCATTTAATGCTTTCTGTAATTTATGAATGGGCTAAACAAACTCCTACAAGTTATCAAA
CAAATATGAATATATATAATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCAGCCAGAG
ATGGAACTCAGCTGTTTCATGCATGACTGAGTCACCTTTCTGGTCAGCTTTTCACTTTAC
TTTCGTATTTTGTATGAGAGGAAGAGACAGAGCAGGCAAAGCACTGCCCCCCCAAGTGCT
GCCTGCTTTGTCTTTATTGCTCTCATGTGACGCCTGGGATTTCACTCAGGGCCTCACCTG
CTGAAGGCAGGTCCTCTCAATACCATCTCCCACCCTAGGATCTACTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved