Erinaceus_europaeus Locus Poly:3:SNORD116
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Poly:3:SNORD116
Erinaceus_europaeus
Poly:3:SNORD116
scaffold_348682
SNORD116, SNORD116, SNORD116
1001..1100, 3383..3480, 8206..8303
9303
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTCCCTGAGCCGTGGCCCGATCT
GTGACCGAAGCGAAGGGAAGCCGCAGCCAGAGACAGAGCCATAGACAGAGCCTGAGCCGG
GCCCGCCTTCTGCCCTTTGGCAGCCTCCCCGAAAGGTGCTGGGATCGATGATGACTCCCC
ACTCACACCAGCATTCCCTTGGAAAAGCTGAACAAAATGAAGTGAGAACCCCCTCCGTCT
ATCTCATCGGTTCTGAGGTCCATGCGGCACATGGTGCGACCCTGAGGCAGCAGGAGTGAG
GGACACATGCCTTGCCGGGTCTTGCCTGCCTGCCCTGGCCTGGCCTGGCCTTGCCTTGCC
TTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTCGCATCGCCTAGCCCTGCA
TAGCCTTACCGAGTTTACCAGGCCTCACCTAACCTGTCTTGGCCTAACCTCCTGGCATCA
AACACCCACTCCCACTCCCACTCCCACTCGCACTCACAGTCCGTCAAGCAGCCATGTCAG
GCAGTGTGGCCCAAAGCAAGGTGGGCCTGTTGGAGCTAGGGTATGGCCTAGGGTGTCCCC
TGGCAGTACTGGCAGCCAGGGTGGTAAGGGTCAGTCAGGGAGTGCAAGGCCGGTCAACAG
GTCTGTGCTGGCCGCCTTGTGGTGGCCTGCATGGCCTCACTCTCTAGAGCCCTCTGGTTT
GTAGGCCTGGGGCCGGGCAAATGGGCATGGTTCTCAATGGGGGTGATTGTGGCTTGAGCA
GCCTGCAGGGTCTCCACCCTTGCCATTGTCCTGTATCTCCAGGGGCTACGAGGAGCAGGG
GGAAGTTGGCGAAGGCTCCAGGGGTCAGAACCATGGCCCTGAGTCTCAGGCCTTAAGCGT
ACCTTCATGAGGCAGAGGGAGTCCAGCGGTGTGGGGTGTTTCCGAGCATGCAGCTTGGGG
ACAGAGCAAGAGTTAGACAGCTGGACTGGGTCCTGGGATCGGGGGTGTGGCCCTAGTCCT
GACTAGTGCTCAGGCAGCCGATGGGAGAGGGAGGCTGGGCCTGGGCATGGGCATGGTCCT
GGGCCAGGGCCTGTGCCAGGGCCCAGGTCACGCTTGGTCCCCTGATTTGGGGGCAGCCTG
AGTTGCAGGCCCCATTTGTGCCTGCCGTGCCCAAGCAGGAAGGCTGGTCTGGTGTGGAGG
TCGCACAGTGGTGATGGGGAGGCCCTTGCATGGGGTATTTGGGCCCCTGGAGGGCCAGGA
GGTCACCTGGGCCTTGATGACTTGCAGACCCAGCCTCTTGTCTCAGTCCCTTTCGTGGCT
TGTGTGTGTTTAGGAAGGAGTCTTTTGGAAGGCCTTATGTGCAGTCCAGAACAGCCAGGG
TGCCTGTGAAGCCTCCTGGGATCCCTGTGGTTCTAGTGTGTAAGTCAGCCTAGCTGGCTG
CACTGCTCCCCGTGGAGGCTGTCAGGCTGTCAGGTGTGCAGGCAGAGGGTGTGAGCTAGG
CTAGGCCAGGCTTGGAGGGGTGTGCTTGGAGGATTTTGGACAGTCATCCGGCCTTTGCTT
CCTGCAGAGGGCAGTGTTGTGCGCCCTGAGGAGGGTGTGAGGGCATGTGGGTGTGAGGGC
CCCAGGGCTGTGTGGCTTAGACCCAAGGCTTGCAGACTGTTTGTGAAGGTAGCAGAGAGC
TGGTCCAGGGCAGAAGCCAGGGGGCCCAAGAGGGTGCCCCGCCAGCAGCATCCCTGCATT
CCCTCTTGCATGCACGCACTCATACACGCCAGGCACCCTCACCAGTCCAAGCCGGCAGCC
ACTTTGGCAGGCAAGCAGGCAGGCAGGCTGGCAGGCAGGCAGGCAGGCTGGCAGGCAGCC
ATTGGCGCCGGCAGGCACCTAGGCCTGTGGGCAGTGGTCAGGGCTAACACCGCAGAGGCC
AGCCTCAGTAGGAGGCAGGCCAGCTGGGTCTTGCCGAGCATGGGCCCAGAGCCCAGCATG
CACCCTGCTGACGCACAGACGTGTTGTCTCCCCACCTCTCAGGTGCATTTGGCTGCCAAG
CGGACTGGACGACCCAGTCGGTGAGGCCAGGCGAGGAGAGGTCCCGGACCCACTTGGCGA
GCCAGCCCAGGAGGCTGTGGCAGAGGCTGGCTGTGGCGGCTGTGTGCGCAGCCTGGCCGA
GGACACCTCCCCCAGGTAAGCTGGCCTTTGGCCCTGGGCAGCTGGGGCCTTGTTGGGGAC
TGGCACTAGGCCTGGCAATGGGTCGGCCTGCAGGGGAGGCTGCTGCTGATGCTGTTGTAG
CGCTGGCGCACAAGGCAGTGGCCGTGGTGGCGGGCTGCAGTGTGCTCCCACGGGGACCCA
CTCTCCCTGGACTGAGCTCAGGGGCTGGGCTCCTCAGGTCCTGTGGGTGCTGCAGGGAGG
GGCTGAGCCTCTCACCCTTTCCCTGAGCCGTGGCCGGATCTGGAGCCGAAGGCGAAGGTG
AAGCCGCAGCCAGAGACAGAGCCATAGACAGAGCCTGAGCCGGGCCCGCCTTCTGCCCTT
TGGCAGCCTCCCCGAAGGTGCTGGGATCGATGATGACTCCCCACTCACACCAGCATTCCT
TGGAAAAGCTGAACAAAATGAGTGAGAACCCCCTCCGTCTATCTCATCGGTTCTGAGGTC
CATGCGGCACATGGTGCGACCCTGAGGCAGCAGGAGTGAGGGACACATGCCTTGCCGGGT
CTTGCCTGGCCTGGCCTGGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC
CTTGCCTCGCATCGCCTAGCCCTGCATAGCCTTACCGAGTTTACCAGGCCTCACCTAACC
TGTCTTGGCCTAACCTCCTGGCATCACACTCCCACTCCCACTCGCACTCACAGTCCGTCA
AGCAGCCATGTCAGGCAGTGTGGCCCAAAGCAAGGTGGGCCTGTTGGAGCTAGGGTATGG
CCTAGGGTGTCCCCTGGCAGTACTGGCAGCCAGGGTGGTAAGGGTCAGTCAGGGAGTGCA
AGGCCGGTCAACAGGTCTGTGCTGGCCACCTTGTGGTGGCCTGCATGGCCTCACTCTCTA
GAGCCCTCTGGTTTGTAGGCCTGGGGCCGGGCAAATGGGCATGGTTCTCAATGGGGGTGA
TTGTGGCTTGAGCAGCCTGCAGGGTCTCCACCCTTGCCATTGTCCTGTATCTCCAGGGGC
TACGAGGAGCAGGGGGAAGTTGGCGAAGGCTCCAGGGGTCAGAACCATGGCCCTGAGTCT
CAGGCCTTAAGCGTACCTTCATGAGGCAGAGGGAGTCCAGCGGTGTGGGGTGTTTCCGAG
CATGCAGCTTGGGGACAGAGCAAGAGTTAGACAGCTGGACTGGGTCCTGGGATCGGGGGT
GTGGCCCTAGTCCTGACTAGTGCTCAGGCAGCCGATGGGAGAGGGAGGCTGGGCCTGGGC
ATGGGCATGGTCCTGGGCCAGGGCCTGTGCCAGGGCCCAGGTCACGCTTGGTCCCCTGAT
TTGGGGGCAGCCTGAGTTGCAGGCCCCATTTGTGCCTGCCGTGCCCAAGCAGGAAGGCTG
GTCTGGTGTGGAGGTCGCACAGTGGTGATGGGGAGGCCCTTGCATGGGGTATTTGGGCCC
CTGGAGGGCCAGGAGGTCACCTGGGCCTTGATGACTTGCAGACCCAGCCTCTTGTCTCAG
TCCCTTTCGTGGCTTGTGTGTGTTTAGGAAGGAGTCTTTTGGAAGGCCTTATGTGCAGTC
CAGAACAGCCAGGGTGCCTGTGAAGCCTCCTGGGATCCCTGTGGTTCTAGTGTGTAAGTC
AGCCTAGCTGGCTGCACTGCTCCCCGTGGAGGCTGTCAGGCTGTCAGGTGTGCAGGCAGA
GGGTGTGAGCTAGGCTAGGCCAGGCTTGGAGGGGTGTGCTTGGAGGCTTTTGGACAGTCA
TCCGGCCTTTGCTTCCTGCAGAGGGCAGTGTTGTGCGCCCTGAGGAGGGTGTGAGGGCAT
GTGGGTGTGAGGGCCCCAGGGCTGTGTGGCTTAGACCCAAGGCTTGCAGACTGTTTGTGA
AGGTAGCAGAGAGCTGGTCCAGGGCAGAAGCCAGGGGGCCCAAGAGGGTGCCCCGCCAGC
AGCATCCCTGCATTCCCTCTTGCATGCACGCACTCATACACGCCAGGCACCCTCACCAGT
CCAAGCCGGCAGCCACTTTGGCAGGCAAGCAGGCAGGCAGGCTGGCAGGCAGGCAGGCAG
GCTGGCAGGCAGCCATTGGCGCCGGCAGGCACCTAGGCCTGTGGGCAGTGGTCAGGGCTA
ACAGCGCAGAGGCCAGCCTCAGTAGGAGGCAGGCCAGCTGGGTCTTGCCGAGCATGGGCC
CAGAGCCCAGCATGCACCCTGCTGACGCACAGACGTGTTGTCTCCCCACCTCTCAGGTGC
ATTTGGCTGCCAAGCGGACTGGACGACCCAGTCGGTGAGGCCAGGCGAGGAGAGGTCCCG
GACCCACTTGGCGAGCCAGCCCAGGAGGCTGTGGCAGAGGCTGGCTGTGGCGGCTGTGTG
CGCAGCCTGGCCGAGGACACCTCCCCCAGGTAAGCTGGCCTTTGGCCCTGGGCAGCTGGG
GCCTTGTTGGGGACTGGCACTAGGCCTGGCAATGGGTCGGCCTGCAGGGGAGGCTGCTGC
TGATGCTGTTGTAGCGCTGGCGCACAAGGCAGTGGCCGTGGTGGCGGGCTGCAGTGTGCT
CCCACGGGGACCCACTCTCCCTGGACTGAGCTCAGGGGCTGGGCTCCTCAGGCCCTGTGG
GTGCTGCAGGGAGGGGCTGAGCCTCTCAGCCTTTCCCTGAGCCGTGCCGGATCTGGAGCC
GAAGGCGAAGGTGAAGCCGCAGCCAGAGACAGAGCCATAGACAGAGCCTGAGCCGGGCCC
GCCTTCTGCCCTTTGGCAGCCTCCCCGGAAGTGCTGGGATCGATGATGANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGATGACTTGCAGACCCAGCCTC
TTGTCTCAGTCCCTTTCGTGGCTTGTGTGTGTTTAGGAAGGAGTCTTTTGGAAGGCCTTA
TGTGCAGTCCAGAACAGCCAGGGTTCCTGTGAAGCCTCCTGGGATCCCTGTGGTTCTAGT
GTGTAAGTCAGCCTAGCTGGCTGCCCTGCTCCCCGTGGAGGCTGTCAGGCTGTCAGGTGT
GCAGGCAGAGGGTGTGAGCTAGGCTAGGTCAGGCTTGGAGGGGTGTGCTTGGAGGATTTT
GGACAGTCATCCGGCCTTTGCTTCCTGCAGAGGGCAGTGTTGTGCGCCCTGAGGAGGGTG
TGAGGGCATGTGGGTGTGAGGGCCCCAGGGCTGTGTGGCTTAGACCCAAGGCTTGCAGAC
TGTTTGTGAAGGTAGCAGAGAGCTGGTCCAGGGCAGAAGCCAGGGGGCCCAAGAGGGTGC
CCCGCCAGCAGCATCCCTGCATTCCCTCTTGCATGCACGCACTCATACACGCCAGGCACC
CTCACCAGTCCAAGCCGGCAGCCACTTTGGCAGGCAAGCAGGCAGGCAGGCTGGCAGGCA
GGCAGGCAGGCTGGCAGGCAGCCATTGGCGCCGGCAGGCACCTAGGCCTGTGGGCAGTGG
TCAGGGCTAACACCGCAGAGGCCAGCCTCAGTAGGAGGCAGGCCAGCTGGGTCTTGCCGA
GCATGGGCCCAGAGCCCAGCATGCACCCTGCTGACGCACAGACGTGTTGTCTCCCCACCT
CTCAGGTGCAAATGGCTGCCAAGCGGACTGGACGACCCAGTCGGTGAGGCCAGGCGAGGA
GAGGTCCCGGACCCACTTGGCGAGCCAGCCCAGGAGGCTGTGGCAGAGGCTGGCTGTGGC
GGCTGTGTGCGCAGCCTGGCCGAGGACACCTCCCCCAGGTAAGCTGGCCTTTGGCCCTGG
GCAGCTGGGGCCTTGTTGGGGACTGGCACTAGGCCTGGCAATGGGTCTGCCTGCATGGGA
GGCTGCTGCTGATGCTGTTGTAGCGCTGGCGCACAAGGCAGTGGCCGTGGTGGCGGGCTG
CAGTGTGCTCCCACGGGGACCCACTCTCCCTGGACTGAGCTCAGGGGCTGGGCTCCTCTG
GCCCTGTGGGTGCTGCAGGGAGGGGCTGAGCCTCTCAGCCTTTCCCTGAGCCGTGGCCGG
ATCTGGAGCCGAAGGCGAAGGTGAAGCCGCAGCCAGAGACAGAGCCATAGACAGAGCCTG
AGCCGGGCCCGCCTTCTGCCCTTTGGCAGCCTCCCCGAAGGTGCTGGGATCGATGATGAC
TCCCCACTCACACCAGCATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACCCCCTCCG
TCTATCTCATCGGTTCTGAGGTCCATGCGGCACATGGTGCGACCCTGAGGCAGCAGGAGT
GAGGGACACATGCCTTGCCGGGTCTGCCTGGCCTGGCCTGGCCTTGCCTTGCCTTGCCTT
GCCTTCCCTTGCCTTGCCTCGCATCGCCTAGCCCTGCATAGCCTTACTGAGTTTACCAGG
CCTCACCTAACCTGTCTTGGCCTAACCTCCTGGCATCACACTCCCACTCCCACTCCCACT
CGCACTCACGGTCCGTCAAGCAGCCATGTCAGGCAGTGTGGCCCAAAGCAAGGTGGGCCT
GTTGGAGCTAGGGTATGGCCTAGGGTGTCCCCTGGCAGTACTGGCAGCCAGGGTGGTAAG
GGTCAGTCAGGGAGTGCAAGGCCGGTCAACAGGTCTGTGCTGGCCGCCTTGTGGTGGCCT
GCATGGCCTCACTCTCTAGAGCCCTCTGGTTTGTAGGCCTGGGGCCGGGCAAATGGGCAT
GGTTCTCAATGGGGGTGATTGTGGCTTGAGCAGCCTGCAGGGTCTCCACCCTTGCCATTG
TCCTGTATCTCCAGGGGCTACGAGGAGCAGGGGGAAGTTGGCGAAGGCTCCAGGGGTCAG
AACCATGGCCCTGAGTCTCAGGCCTTAAGCATACCTTCATGAGGCAGAGGGAGTCCAGCG
GTGTGGGGTGTTTCCGAGCATGCAGCTTGGGGACAGAGCAAGAGTTAGACAGCTGGACTG
GGTCCTGGGATCGGGGGTGTGGCCCTAGTCCTGACTAGTGCTCAGGCAGCCGATGGGAGA
GGGAGGCTGGGCCTGGGCATGGGCATGGTCCTGGGCCAGGGCCTGTGCCAGGGCCCAGGT
CACGCTTGGTCCCCTGATTTGGGGGCAGCCTGAGTTGCAGGCCCCATTTGTGCCTGCCGT
GCCCAAGCAGGAAGGCTGGTCTGGTGTGGAGGTCGCACAGTGGTGATGGGGAGGCCCTTG
CATGGGTTTGGGTCCGTGGAGAGCCAGGAGGTCACCTGAGCCTTGATGTCTTGCAGGCCC
TGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved