Erinaceus_europaeus Locus Mono:351:SNORA17
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:351:SNORA17
Erinaceus_europaeus
Mono:351:SNORA17
scaffold_290165
SNORA17
1001..1131
2131
AAAGAGAGTTAACATATAAAGCCAAACAAATTGATGACTAATTATGAACCTAAAGGCTT
GAATAGTGCAGATGAAGAGTTGGGGGGGTATCTCCATTTTGTAGATAGCTAGTAGGCATA
TTTTAGTTATATTCCAAAGTGCCTGTGGCTATACTAGTTTTTCTTTTCTTTTTTTTTTTT
TTTAATGAGACCAGTGTGTGCATGGCCAAGATCAACCCTAAGACCTTAAGTCCTTTATTC
TATTCAATGAACCACCTCCCTAACTGCTCGATTATAATTGCATTATGACATAGTATAGGT
TTTATGTGTACAGACTTTTAAATAAACATTTACCTGTATTTAATGCCAACATTCTAATAA
AAAAAAACCCTGTGTATTCTAAAACCATATTCTTTGCATTCTAAAAGAACTTAATGTTCT
AGAAGTTTCATATGCATCATTTTGTTAAAATTACTTATTATCTGGGAGGTACCATGATAG
CCAGAGCGATGGATTTATCAGCAGGAAGGACTGAATTTGATTTCCAGTATCAAATGTACC
AGGGTGATGTTCAGATTCTCTCTCATTCTCCTCTCTCATAAATACCTTTTCCCCTCCTCT
CTCATAAATAAATCAATAAATCTTAATAAATAAAATAGCTTAACATTATAAAATGAGTTA
TTTTCTTTATCTTAGAGGTGATTAACTAGAAGCAAAGAAAAGTAAAATCAGAGTCCTAAG
CTAATATATGGCACATTGGGGTTAGAACCAAGTTAATTTGTTCATGAACACCTGATTTTA
CTTGATGCTATTTTTTAAAAAAATATTTATAGGGCAACAAAAGAGGGGGAAAAAGCCTCC
AGGAGCAGTTGGTTCATGGTGCAGGCACTGAGCCCCAGCAATAACCTTGGAGGCAAAAAA
ATAATAATATTTATTTATGCTTACTTCTTTATTTATTTTGGATAGAGACAGAAAATAAGA
GGGCAGGGAGAGGTTGAGAGAGATAAAAAGAGACACTTGTCCCTGCCCCTAGAGGTGTTA
CAGATGTGACTGCTGTGTCACATGTGTATCAATAGGTGGCAGAGAGAAGAGAGGCTTGTC
TATGTCCAGTGCTCTGACCTGTGAGCCACTGGGTGATTGATAGTCTGACACTCAGCACGG
CGCCCCCCGTCTGTTACAGCGTGTTTATTGGCAACCCGAATCCTGTCGTGTAAGAAAACT
TATTCTTCCTTAGTTCCTGCCTGCCCTCAAGTCTCGAGGCGACCCTGTGACCTGAAGACT
GGTGTTCATCCCTGTTGGATGAAAAGTGATGGCTCACATTCAAGGGGAAGGTAGGTGACC
ATTAGCCTGTGACAACGACCTTATGGAACGTCTGACCTCTGTCCAAGACCAGGTTACCAG
CCAGTCCAGCATCCAGAGGTGGCGTTAGATCATCTGAGAGATCTGATCACCAAATGGTAC
AGTGACCTTACCAGACAGACCAGTATCCTCAACCTTGTAGCAGATGCCAAGAGATCAGAA
AAATGCTAGAATGGAAGGCTACTCTGCATCCTCCAGAGGCATTCACACAATCATGGAGAT
CCACAGCTGATCAAGCTCAGGGCCTCACAGCACTGAGTACTCCCCCACTGCTCTCCTAGT
TCATGAATTTGGGAGGGAGGGGGTGTGTTTGGTTCCCTAAAGTAAAATTAAAGGGACTTT
GGAATTTGAAAATAAAAAAAAAGAGAGACACTTGTAACACTGTTTCACCACTCATGAAGC
TTCCCCCCTTGCAGGTGGAAATACTGGCTTAAACCTGGGTCCTTGTGCATTGTAATGTGT
GCTTTACCAGATGCACCACCACCTGGCCCCTGATGTTATTAATGCATATAAAGAGAAGGA
AATGAATAACAAAGGTCTGAGAGCAAGCTTGAATTATGCATGGGTGTGACTCTAAAACAT
CCTGAGATTTTTCTGAAAGGCAATATAAAGTTGCTTTATGTGTAACTAAATGCCACACAA
CACATCATGGCTTGTTGTTGTTGACTGCCATATTGTCTATATGAATATTTTGAAAATGCC
AGACACAGTCCCTTCATTTCTACAAGTTTGACACGTGACCATGATCATCTCCAAATATAA
ACTGAATTCATGTTTCTCTAGTAACAGTCAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved