Erinaceus_europaeus Locus Mono:398:SNORD62
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:398:SNORD62
Erinaceus_europaeus
Mono:398:SNORD62
GeneScaffold_6189
SNORD62
1001..1087
2087
CTTTTGTTTTCCTTGCAGTTGGTACTGAAATCTTTGAAGACATTTCCAAAGCAGATTGT
GTCAATGTCTTCTTCGGTGTATTTGGTGGCTTCTAATTTGTCCTTATCTGTGATCTATTT
GGAATTGCCTTTTGTCTTAATATGGTGGTTCATGCCGGGATAGCCTGAGGGTGCTTCTTC
CTGAGCAAGTGCTCTCTAGGTTGAAGAGAACTCAACTGGAGCCAATCTAGGCTGCTGCGT
GGGAGAGGGATGAGGAACTCGTGCCGAGCTAACGTCGCAGGAGATACACTCTGGAACTCT
TGGAGCCGGAAAGCAATTCCAAGTGATTTTACTCAGAAAAGCCGCTTGTATATATACTAG
TCAAGTAGGGTGGAAACAGGGTGTGATGTAGAGAGGGTGGAGCGAAAAAGGACTGGTGGA
GATCAGGGTGTACTAGGAGAGGGAGCGGAGCAAAAAGACATCATGAACCAGTGGGGATTA
AACCAATGCCCTGGAGGGAGGGTGGTGCTTAGTTAACAGGGTTTATGTAAATAGACCTCA
GCTTTAAGTGGGATTAAACCAATGCCCTGCAGGCATGCCAGTGTTTAGTTAAGCAGGATT
AGAGACAGAAGCTTTAAACCGGGGGAGCTGGCATACTACCCAACAGGTTCAGTTTTATTC
TTTTGCATACATTGACCCATTTTCCCCACCATTGTTGAAGACTCCTTTCTTCACATGATG
TCTTGGGGGCTCATTACCAAAATTTAGTTGTCTCTAAGTGTGGGGGTCTTATTTCTGGGT
TCAATCCTATCCCACTTGTCTGTTGTGCCTACTTTTGTTACAAAATTGGAGTTTTGATTA
CAGTAGATCTATGGTATAATTTGAGGTGAGGAAGTATGATGTTTACTTTCTTGTTCTTTT
TTTTTTCCTCTCAGGATTGCTTTGGCGATTAGGTATTTTCTCATTCCAGGTAAGACTTGG
GTACTATATTCCCTTTATAGCAATTAGAAATAAAAAACTTCTTCTCAATGATGCAACTCC
AATAGATCCTTCTGAGCCTCCACTGGGGACTCAATAGCAGGGAGATGAAGAGGAAAAATA
AAAAACAACCCCCGCAAAAAAAAAAAAACAAAAAAAAACTGTGGACTTTTTGTTTTGGGG
TTTAACAAATGGGGGAGGCTTATTATATCATAGGTTACTTAGGTACATAAAAAAACCATG
ACAGCAAAATGGGCTAAGGAGGAAAGAACAGTTAGTCATGATGGTGGGGAGCCATGAGTC
TTTAAGCTTAGTTCCCAATGTCCAGATACACTAGTTCAGATTCTGGGGGAAGTAGCGTGG
TGGGTCCAGGCAGAAGGCATAAGTAAGGGAAGAGCAGCAGAAGCAGAAAGGCTGATTTCT
GCCAGACATTTATTTAAATAACATCCTATACACCTACAGTCCTCTGTGGGTTTGTGTGTG
ACTGTCATAAGCTTGTCAGGCTGCTATCAGACATATGCTAATTACATTCATATCTCAATA
CCTTTGAAGAAATTTGCTAGGGTCTTAATAGAGCTTTGCATAAATCCATATAGTGTCCTT
GGTAGTATGGTCATTTCGATAGTGTTAATTCTTCCAACCCATGAGTATGGTATATCTTTC
CATTTTTAAAGATTTTATCTACTTTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTTCCCGCTTTTTCTTCCTTTATCTTTTAACAGAGCACTACTCAGCTCTGGCTTATA
GTGGTGTGGGGGATCTACTCTGGGACTATGTTATCTCCCCTGCTGGTTGGGATTTCTTAA
TATGCTAACATATCATCTGTAAACAGTGACATTAGTCCTCCTATCTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved